p16INK4A (CDKN2A) Human qPCR Primer Pair (NM_058195)

CAT#: HP226191

qSTAR qPCR primer pairs against Homo sapiens gene CDKN2A



CNY 1,140.00


货期*
5周

规格
    • 200 reactions

Cited in 1 publication.

Product images

经常一起买 (7)
Anti-CDKN2A (p16INK4a) mouse monoclonal antibody, clone OTI4C11 (formerly 4C11)
    • 100 ul

CNY 1,999.00
CNY 2,700.00


CDKN2A (Myc-DDK-tagged)-Human cyclin-dependent kinase inhibitor 2A (melanoma, p16, inhibits CDK4) (CDKN2A), transcript variant 1
    • 10 ug

CNY 1,800.00
CNY 4,180.00


First Strand cDNA Synthesis Kit (11801-100)
    • 100 reactions

CNY 4,180.00


First Strand cDNA Synthesis Kit (11801-025)
    • 25 reactions

CNY 1,330.00


CDKN2A (Myc-DDK-tagged)-Human cyclin-dependent kinase inhibitor 2A (melanoma, p16, inhibits CDK4) (CDKN2A), transcript variant 4
    • 10 ug

CNY 2,400.00
CNY 3,705.00


CDKN2A (Myc-DDK-tagged)-Human cyclin-dependent kinase inhibitor 2A (melanoma, p16, inhibits CDK4) (CDKN2A), transcript variant 5
    • 10 ug

CNY 3,600.00
CNY 5,130.00


CDKN2A (Myc-DDK-tagged)-Human cyclin-dependent kinase inhibitor 2A (melanoma, p16, inhibits CDK4) (CDKN2A), transcript variant 3
    • 10 ug

CNY 1,320.00
CNY 3,990.00

Specifications

Product Data
Gene ID 1029
Forward Sequence CTCGTGCTGATGCTACTGAGGA
Reverse Sequence GGTCGGCGCAGTTGGGCTCC
Synonyms ARF; CDK4I; CDKN2; CMM2; INK4; INK4A; MLM; MTS-1; MTS1; P14; P14ARF; P16; P16-INK4A; P16INK4; P16INK4A; P19; P19ARF; TP16
Quality Control The primer mix has been tested to generate satisfactory qPCR data on ABI 7900HT by using the following PCR program: Stage 1: Activation: 50 °C for 2 min; Stage 2: pre-soak:95 °C for 10 min; Stage 3: Denaturation: 95 °C for 15 sec, Annealing: 60°C for 1 min; Stage 4: Melting curve: 95°C for 15 sec, 60°C for 15 sec, 95°C for 15 sec.
Storage & Stability Store at -20°C.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Citations (1)

Documents

Customer Reviews 
Loading...