SYT homolog 1 (SS18L1) Human qPCR Primer Pair (NM_015558)

Specifications

Product Data
Gene ID	26039
Forward Sequence	GAAGATGCTGGACGAGAACCAC
Reverse Sequence	GTTCTGGTTGGAGTCTGCGATC
Synonyms	calcium-responsive transactivator; CREST; CREST, LP2261, KIAA0693, MGC26711, MGC78386; KIAA0693; LP2261; MGC26711; MGC78386; OTTHUMP00000031468; SS18-like protein 1; synovial sarcoma translocation gene on chromosome 18-like 1; SYT homolog 1
Quality Control	The primer mix has been tested to generate satisfactory qPCR data on ABI 7900HT by using the following PCR program: Stage 1: Activation: 50 °C for 2 min; Stage 2: pre-soak:95 °C for 10 min; Stage 3: Denaturation: 95 °C for 15 sec, Annealing: 60°C for 1 min; Stage 4: Melting curve: 95°C for 15 sec, 60°C for 15 sec, 95°C for 15 sec.
Storage & Stability	Store at -20°C.

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.