p73 (TP73) Human qPCR Primer Pair (NM_005427)

CAT#: HP208561

qSTAR qPCR primer pairs against Homo sapiens gene TP73



CNY 1140.00


货期*
5周

规格
    • 200 reactions

Product images

推荐一起购买 (17)
TP73 mouse monoclonal antibody, clone OTI2H5 (formerly 2H5)
    • 100 ul

CNY 1999.00
CNY 2700.00


A ready-to-use mix for SYBR Green qPCR, containing ROX reference and suitable for all qPCR instruments without adjusting the concentration of ROX.
    • 4 x 1.25 ml (500 rxns/20ul reaction)

CNY 2710.00


First Strand cDNA Synthesis Kit (11801-100)
    • 100 reactions

CNY 4180.00


TP73 (Myc-DDK-tagged)-Human tumor protein p73 (TP73), transcript variant 1
    • 10 ug

CNY 4736.00


TP73 (Myc-DDK tagged) - Homo sapiens tumor protein p73 (TP73), transcript variant 12
    • 10 ug

CNY 4560.00


First Strand cDNA Synthesis Kit (11801-025)
    • 25 reactions

CNY 1330.00


TP73 (Myc-DDK tagged) - Homo sapiens tumor protein p73 (TP73), transcript variant 10
    • 10 ug

CNY 3990.00


TP73 (Myc-DDK tagged) - Homo sapiens tumor protein p73 (TP73), transcript variant 8
    • 10 ug

CNY 4940.00


TP73 (Myc-DDK-tagged)-Human tumor protein p73 (TP73), transcript variant 2
    • 10 ug

CNY 6552.00


TP73 (Myc-DDK tagged) - Homo sapiens tumor protein p73 (TP73), transcript variant 11
    • 10 ug

CNY 4560.00


TP73 (Myc-DDK tagged) - Homo sapiens tumor protein p73 (TP73), transcript variant 9
    • 10 ug

CNY 4750.00


TP73 (Myc-DDK-tagged)-Human tumor protein p73 (TP73), transcript variant 4
    • 10 ug

CNY 5488.00


TP73 (Myc-DDK tagged) - Homo sapiens tumor protein p73 (TP73), transcript variant 6
    • 10 ug

CNY 4560.00


TP73 (Myc-DDK tagged) - Homo sapiens tumor protein p73 (TP73), transcript variant 5
    • 10 ug

CNY 3990.00


TP73 (Myc-DDK tagged) - Homo sapiens tumor protein p73 (TP73), transcript variant 13
    • 10 ug

CNY 5610.00


TP73 (Myc-DDK tagged) - Homo sapiens tumor protein p73 (TP73), transcript variant 7
    • 10 ug

CNY 3990.00


TP73 (Myc-DDK-tagged)-Human tumor protein p73 (TP73), transcript variant 3
    • 10 ug

CNY 3656.00
CNY 3990.00

Specifications

Product Data
Gene ID 7161
Forward Sequence CATGGAGACGAGGACACGTACT
Reverse Sequence TGCCGATAGGAGTCCACCAGTG
Synonyms P73
Quality Control The primer mix has been tested to generate satisfactory qPCR data on ABI 7900HT by using the following PCR program: Stage 1: Activation: 50 °C for 2 min; Stage 2: pre-soak:95 °C for 10 min; Stage 3: Denaturation: 95 °C for 15 sec, Annealing: 60°C for 1 min; Stage 4: Melting curve: 95°C for 15 sec, 60°C for 15 sec, 95°C for 15 sec.
Storage & Stability Store at -20°C.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...