JAK2 Human qPCR Primer Pair (NM_004972)
CNY 1140.00
Cited in 4 publications. |
Product images

CNY 2710.00
CNY 1999.00
CNY 2700.00
Specifications
Product Data | |
Gene ID | 3717 |
Forward Sequence | CCAGATGGAAACTGTTCGCTCAG |
Reverse Sequence | GAGGTTGGTACATCAGAAACACC |
Synonyms | JTK10 |
Quality Control | The primer mix has been tested to generate satisfactory qPCR data on ABI 7900HT by using the following PCR program: Stage 1: Activation: 50 °C for 2 min; Stage 2: pre-soak:95 °C for 10 min; Stage 3: Denaturation: 95 °C for 15 sec, Annealing: 60°C for 1 min; Stage 4: Melting curve: 95°C for 15 sec, 60°C for 15 sec, 95°C for 15 sec. |
Storage & Stability | Store at -20°C. |
Citations (4)
The use of this Gene Expression has been cited in the following citations: |
---|
Alloimmune Responses of Humanized Mice to Human Pluripotent Stem Cell Therapeutics
,Kooreman, NG;de Almeida, PE;Stack, JP;Nelakanti, RV;Diecke, S;Shao, NY;Swijnenburg, RJ;Sanchez-Freire, V;Matsa, E;Liu, C;Connolly, AJ;Hamming, JF;Quax, PHA;Brehm, MA;Greiner, DL;Shultz, LD;Wu, JC;,
Cell Rep
,PubMed ID 28834758
[JAK2]
|
Ruxolitinib as potential targeted therapy for patients with JAK2 rearrangements
,null,
Haematologica
,PubMed ID 22875628
[JAK2]
|
A CK2-dependent mechanism for activation of the JAK-STAT signaling pathway
,Ying Zheng, Hongwei Qin, Stuart J. Frank, Luqin Deng, David W. Litchfield, Ayalew Tefferi, Animesh Pardanani, Fang-Tsyr Lin, Jingzhi Li, Bingdong Sha, and Etty N. Benveniste,
Blood, Jul 2011; 118: 156 - 166.
[JAK2]
|
Recombinant Human Erythropoietin Antagonizes Trastuzumab Treatment of Breast Cancer Cells via Jak2-Mediated Activation of Src and Inactivation of PTEN
,null,
Cancer cell
,PubMed ID 21075308
[JAK2]
|
Documents
FAQs |
Resources
基因表达相关资源 |