ABCG2 Human qPCR Primer Pair (NM_004827)
CNY 1140.00
| Cited in 4 publications. | 
Product images
 
                    
                CNY 2710.00
CNY 7328.00
Specifications
| Product Data | |
| Gene ID | 9429 | 
| Forward Sequence | GTTCTCAGCAGCTCTTCGGCTT | 
| Reverse Sequence | TCCTCCAGACACACCACGGATA | 
| Synonyms | ABC15; ABCP; BCRP; BCRP1; BMDP; CD338; CDw338; EST157481; GOUT1; MRX; MXR; MXR-1; MXR1; UAQTL1 | 
| Quality Control | The primer mix has been tested to generate satisfactory qPCR data on ABI 7900HT by using the following PCR program: Stage 1: Activation: 50 °C for 2 min; Stage 2: pre-soak:95 °C for 10 min; Stage 3: Denaturation: 95 °C for 15 sec, Annealing: 60°C for 1 min; Stage 4: Melting curve: 95°C for 15 sec, 60°C for 15 sec, 95°C for 15 sec. | 
| Storage & Stability | Store at -20°C. | 
Citations (4)
| The use of this Gene Expression has been cited in the following citations: | 
|---|
| Assessing stemness and proliferation properties of the newly established colon cancer 'stem' cell line, CSC480 and novel approaches to identify dormant cancer cells
                                                ,Alowaidi, F;Hashimi, SM;Alqurashi, N;Alhulais, R;Ivanovski, S;Bellette, B;Meedenyia, A;Lam, A;Wood, S;,
                                                Oncol. Rep.
                                                ,PubMed ID 29693155
                                                [ABCG2] | 
| Enhancement of Cancer-Specific Protoporphyrin IX Fluorescence by Targeting Oncogenic Ras/MEK Pathway
                                                ,null,
                                                Theranostics
                                                ,PubMed ID 29721068
                                                [ABCG2] | 
| Induction of Stemlike Cells with Fibrogenic Properties by Carbon Nanotubes and Its Role in Fibrogenesis
                                                ,null,
                                                Nano Letters
                                                ,PubMed ID 24873662
                                                [ABCG2] | 
| Influence of HIV antiretrovirals on methadone N-demethylation and transport.
                                                ,null,
                                                Biochemical pharmacology
                                                ,PubMed ID 25801005
                                                [ABCG2] | 
Documents
| FAQs | 
Resources
| 基因表达相关资源 | 

 
        