MMP2 Human qPCR Primer Pair (NM_004530)
CNY 1140.00
Cited in 4 publications. |
Product images

CNY 1999.00
CNY 2700.00
CNY 7368.00
CNY 2710.00
CNY 4560.00
CNY 4544.00
CNY 5420.00
CNY 4560.00
CNY 4560.00
Specifications
Product Data | |
Gene ID | 4313 |
Forward Sequence | AGCGAGTGGATGCCGCCTTTAA |
Reverse Sequence | CATTCCAGGCATCTGCGATGAG |
Synonyms | CLG4; CLG4A; MMP-2; MMP-II; MONA; TBE-1 |
Quality Control | The primer mix has been tested to generate satisfactory qPCR data on ABI 7900HT by using the following PCR program: Stage 1: Activation: 50 °C for 2 min; Stage 2: pre-soak:95 °C for 10 min; Stage 3: Denaturation: 95 °C for 15 sec, Annealing: 60°C for 1 min; Stage 4: Melting curve: 95°C for 15 sec, 60°C for 15 sec, 95°C for 15 sec. |
Storage & Stability | Store at -20°C. |
Citations (4)
The use of this Gene Expression has been cited in the following citations: |
---|
Distinct Ring1b complexes defined by DEAD-box helicases and EMT transcription factors synergistically enhance E-cadherin silencing in breast cancer
,Wang, Y;Sun, Y;Shang, C;Chen, L;Chen, H;Wang, D;Zeng, X;,
Cell death & disease
,PubMed ID 33608512
[MMP2]
|
Influence of shear stress on phenotype and MMP production of smooth muscle cells in a co-culture model
,Han, X;Sakamoto, N;Tomita, N;Meng, H;Sato, M;Ohta, M;,
J Biorheol
[MMP2]
|
Cyclophosphamide promotes breast cancer cell migration through CXCR4 and matrix metalloproteinases
,Hung, CM;Hsu, YC;Chen, TY;Chang, CC;Lee, MJ;,
Cell Biol. Int
,PubMed ID 28035725
[MMP2]
|
Ang II-AT1R Increases Cell Migration Through PI3K/AKT and NF-?B Pathways in Breast Cancer
,Zhao, Y;Wang, H;Li, X;Cao, M;Lu, H;Meng, Q;Pang, H;Li, H;Nadolny, C;Dong, X;Cai, L;,
J. Cell. Physiol. April 2014
,PubMed ID 24692224
[MMP2]
|
Documents
FAQs |
Resources
基因表达相关资源 |