RAB3D Human qPCR Primer Pair (NM_004283)
CNY 1140.00
| Cited in 2 publications. |
Product images
CNY 2400.00
CNY 3705.00
CNY 2710.00
Specifications
| Product Data | |
| Gene ID | 9545 |
| Forward Sequence | ACGTGTTGTGCCTGCTGAGGAT |
| Reverse Sequence | CTTCTCGCAGATGACATCCACC |
| Synonyms | D2-2; GOV; RAB16; RAD3D |
| Quality Control | The primer mix has been tested to generate satisfactory qPCR data on ABI 7900HT by using the following PCR program: Stage 1: Activation: 50 °C for 2 min; Stage 2: pre-soak:95 °C for 10 min; Stage 3: Denaturation: 95 °C for 15 sec, Annealing: 60°C for 1 min; Stage 4: Melting curve: 95°C for 15 sec, 60°C for 15 sec, 95°C for 15 sec. |
| Storage & Stability | Store at -20°C. |
Citations (2)
| The use of this Gene Expression has been cited in the following citations: |
|---|
|
Exploring transcriptional regulators Ref-1 and STAT3 as therapeutic targets in malignant peripheral nerve sheath tumours
,Gampala, S;Shah, F;Zhang, C;Rhodes, SD;Babb, O;Grimard, M;Wireman, RS;Rad, E;Calver, B;Bai, RY;Staedtke, V;Hulsey, EL;Saadatzadeh, MR;Pollok, KE;Tong, Y;Smith, AE;Clapp, DW;Tee, AR;Kelley, MR;Fishel, ML;,
British journal of cancer
,PubMed ID 33658640
[RAB3D]
|
|
Combined inhibition of Ref-1 and STAT3 leads to synergistic tumour inhibition in multiple cancers using 3D and in vivo tumour co-culture models
,Caston, RA;Shah, F;Starcher, CL;Wireman, R;Babb, O;Grimard, M;McGeown, J;Armstrong, L;Tong, Y;Pili, R;Rupert, J;Zimmers, TA;Elmi, AN;Pollok, KE;Motea, EA;Kelley, MR;Fishel, ML;,
Journal of cellular and molecular medicine
,PubMed ID 33274592
[RAB3D]
|
Documents
| FAQs |
Resources
| 基因表达相关资源 |

