MDM2 Human qPCR Primer Pair (NM_002392)

CAT#: HP206085

qSTAR qPCR primer pairs against Homo sapiens gene MDM2



CNY 1,140.00


货期*
5周

规格
    • 200 reactions

Cited in 1 publication.

Product images

经常一起买 (8)
MDM2 mouse monoclonal antibody, clone OTI1E6 (formerly 1E6)
    • 100 ul

CNY 1,999.00
CNY 2,700.00


MDM2 (Myc-DDK-tagged)-Human Mdm2 p53 binding protein homolog (mouse) (MDM2), transcript variant MDM2
    • 10 ug

CNY 5,488.00


First Strand cDNA Synthesis Kit (11801-100)
    • 100 reactions

CNY 4,180.00


First Strand cDNA Synthesis Kit (11801-025)
    • 25 reactions

CNY 1,330.00


Myc-DDK-tagged ORF clone of Homo sapiens Mdm2 p53 binding protein homolog (mouse) (MDM2), transcript variant MDM2g as transfection-ready DNA
    • 10 ug

CNY 3,656.00
CNY 3,990.00


MDM2 (myc-DDK-tagged) - Human MDM2 proto-oncogene, E3 ubiquitin protein ligase (MDM2), transcript variant 5
    • 10 ug

CNY 2,640.00


Myc-DDK-tagged ORF clone of Homo sapiens Mdm2 p53 binding protein homolog (mouse) (MDM2), transcript variant MDM2h as transfection-ready DNA
    • 10 ug

CNY 3,656.00
CNY 3,990.00


MDM2 (Myc-DDK-tagged)-Human Mdm2 p53 binding protein homolog (mouse) (MDM2), transcript variant MDM2i
    • 10 ug

CNY 2,400.00
CNY 3,990.00

Specifications

Product Data
Gene ID 4193
Forward Sequence TGTTTGGCGTGCCAAGCTTCTC
Reverse Sequence CACAGATGTACCTGAGTCCGATG
Synonyms ACTFS; hdm2; HDMX; LSKB
Quality Control The primer mix has been tested to generate satisfactory qPCR data on ABI 7900HT by using the following PCR program: Stage 1: Activation: 50 °C for 2 min; Stage 2: pre-soak:95 °C for 10 min; Stage 3: Denaturation: 95 °C for 15 sec, Annealing: 60°C for 1 min; Stage 4: Melting curve: 95°C for 15 sec, 60°C for 15 sec, 95°C for 15 sec.
Storage & Stability Store at -20°C.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Citations (1)

Documents

Customer Reviews 
Loading...