Interferon gamma (IFNG) Human qPCR Primer Pair (NM_000619)
CNY 1140.00
Cited in 3 publications. |
Product images

CNY 2710.00
CNY 1999.00
CNY 2700.00
Specifications
Product Data | |
Gene ID | 3458 |
Forward Sequence | GAGTGTGGAGACCATCAAGGAAG |
Reverse Sequence | TGCTTTGCGTTGGACATTCAAGTC |
Synonyms | IFG; IFI; IMD69 |
Quality Control | The primer mix has been tested to generate satisfactory qPCR data on ABI 7900HT by using the following PCR program: Stage 1: Activation: 50 °C for 2 min; Stage 2: pre-soak:95 °C for 10 min; Stage 3: Denaturation: 95 °C for 15 sec, Annealing: 60°C for 1 min; Stage 4: Melting curve: 95°C for 15 sec, 60°C for 15 sec, 95°C for 15 sec. |
Storage & Stability | Store at -20°C. |
Citations (3)
The use of this Gene Expression has been cited in the following citations: |
---|
HDAC6 plays a non-canonical role in the regulation of anti-tumor immune responses, dissemination, and invasiveness of breast cancer
,Banik, D;Noonepalle, S;Hadley, M;Palmer, E;Gracia-Hernandez, M;Zevallos-Delgado, C;Manhas, N;Simonyan, H;Young, CN;Popratiloff, A;Chiappinelli, KB;Fernandes, R;Sotomayor, EM;Villagra, A;,
Cancer Res.
,PubMed ID 32605998
[IFNG]
|
Alloimmune Responses of Humanized Mice to Human Pluripotent Stem Cell Therapeutics
,Kooreman, NG;de Almeida, PE;Stack, JP;Nelakanti, RV;Diecke, S;Shao, NY;Swijnenburg, RJ;Sanchez-Freire, V;Matsa, E;Liu, C;Connolly, AJ;Hamming, JF;Quax, PHA;Brehm, MA;Greiner, DL;Shultz, LD;Wu, JC;,
Cell Rep
,PubMed ID 28834758
[IFNG]
|
NLRC4 suppresses melanoma tumor progression independently of inflammasome activation
,Janowski, AM;Colegio, OR;Hornick, EE;McNiff, JM;Martin, MD;Badovinac, VP;Norian, LA;Zhang, W;Cassel, SL;Sutterwala, FS;,
J. Clin. Invest.
,PubMed ID 27617861
[IFNG]
|
Documents
FAQs |
Resources
基因表达相关资源 |