Arrb1 Mouse Gene Knockout Kit (CRISPR)

CAT#: KN501616

Arrb1 - KN2.0, Mouse gene knockout kit via CRISPR, non-homology mediated.




 KN2.0 knockout kit validation

  See Other Versions

CNY 8680.00

CNY 12260.00


货期*
2周

规格
    • 1 kit

Product images

推荐一起购买 (2)
pCAS-Scramble, pCas-Guide vector with a scrambled sequence as a negative control (10 µg)
    • 10 ug

CNY 3710.00


Arrb1 (Myc-DDK-tagged) - Mouse arrestin, beta 1 (Arrb1), transcript variant b
    • 10 ug

CNY 3656.00

Specifications

Product Data
Format 2 gRNA vectors, 1 linear donor
Donor DNA EF1a-GFP-P2A-Puro
Symbol Arrb1
UniProt ID Q8BWG8
Locus ID 109689
Kit Components

KN501616G1, Arrb1 gRNA vector 1 in pCas-Guide CRISPR vector

KN501616G2, Arrb1 gRNA vector 2 in pCas-Guide CRISPR vector

KN501616D, Linear donor DNA containing LoxP-EF1A-tGFP-P2A-Puro-LoxP

LoxP-EF1A-tGFP-P2A-Puro-LoxP (2739 bp)

The sequence below is cassette sequence only. The linear donor DNA also contains proprietary target sequence.
ATAACTTCGTATAATGTATGCTATACGAAGTTAT CGTGAGGCTCCGGTGCCCGTCAGTGGGCAGAGCGCACATCGCCCACAGTCCCCGAGAAGTTGGGGGGAGGGGTCGGCAATTGAACCGGTGCCTAGAGAAGGTGGCGCGGGGTAAACTGGGAAAGTGATGTCGTGTACTGGCTCCGCCTTTTTCCCGAGGGTGGGGGAGAACCGTATATAAGTGCAGTAGTCGCCGTGAACGTTCTTTTTCGCAACGGGTTTGCCGCCAGAACACAGGTAAGTGCCGTGTGTGGTTCCCGCGGGCCTGGCCTCTTTACGGGTTATGGCCCTTGCGTGCCTTGAATTACTTCCACCTGGCTGCAGTACGTGATTCTTGATCCCGAGCTTCGGGTTGGAAGTGGGTGGGAGAGTTCGAGGCCTTGCGCTTAAGGAGCCCCTTCGCCTCGTGCTTGAGTTGAGGCCTGGCCTGGGCGCTGGGGCCGCCGCGTGCGAATCTGGTGGCACCTTCGCGCCTGTCTCGCTGCTTTCGATAAGTCTCTAGCCATTTAAAATTTTTGATGACCTGCTGCGACGCTTTTTTTCTGGCAAGATAGTCTTGTAAATGCGGGCCAAGATCTGCACACTGGTATTTCGGTTTTTGGGGCCGCGGGCGGCGACGGGGCCCGTGCGTCCCAGCGCACATGTTCGGCGAGGCGGGGCCTGCGAGCGCGGCCACCGAGAATCGGACGGGGGTAGTCTCAAGCTGGCCGGCCTGCTCTGGTGCCTGGCCTCGCGCCGCCGTGTATCGCCCCGCCCTGGGCGGCAAGGCTGGCCCGGTCGGCACCAGTTGCGTGAGCGGAAAGATGGCCGCTTCCCGGCCCTGCTGCAGGGAGCTCAAAATGGAGGACGCGGCGCTCGGGAGAGCGGGCGGGTGAGTCACCCACACAAAGGAAAAGGGCCTTTCCGTCCTCAGCCGTCGCTTCATGTGACTCCACGGAGTACCGGGCGCCGTCCAGGCACCTCGATTAGTTCTCGAGCTTTTGGAGTACGTCGTCTTTAGGTTGGGGGGAGGGGTTTTATGCGATGGAGTTTCCCCACACTGAGTGGGTGGAGACTGAAGTTAGGCCAGCTTGGCACTTGATGTAATTCTCCTTGGAATTTGCCCTTTTTGAGTTTGGATCTTGGTTCATTCTCAAGCCTCAGACAGTGGTTCAAAGTTTTTTTCTTCCATTTCAGGTGTCGTGA ATGGAGAGCGACGAGAGCGGCCTGCCCGCCATGGAGATCGAGTGCCGCATCACCGGCACCCTGAACGGCGTGGAGTTCGAGCTGGTGGGCGGCGGAGAGGGCACCCCCGAGCAGGGCCGCATGACCAACAAGATGAAGAGCACCAAAGGCGCCCTGACCTTCAGCCCCTACCTGCTGAGCCACGTGATGGGCTACGGCTTCTACCACTTCGGCACCTACCCCAGCGGCTACGAGAACCCCTTCCTGCACGCCATCAACAACGGCGGCTACACCAACACCCGCATCGAGAAGTACGAGGACGGCGGCGTGCTGCACGTGAGCTTCAGCTACCGCTACGAGGCCGGCCGCGTGATCGGCGACTTCAAGGTGATGGGCACCGGCTTCCCCGAGGACAGCGTGATCTTCACCGACAAGATCATCCGCAGCAACGCCACCGTGGAGCACCTGCACCCCATGGGCGATAACGATCTGGATGGCAGCTTCACCCGCACCTTCAGCCTGCGCGACGGCGGCTACTACAGCTCCGTGGTGGACAGCCACATGCACTTCAAGAGCGCCATCCACCCCAGCATCCTGCAGAACGGGGGCCCCATGTTCGCCTTCCGCCGCGTGGAGGAGGATCACAGCAACACCGAGCTGGGCATCGTGGAGTACCAGCACGCCTTCAAGACCCCGGATGCAGATGCCGGTGAAGAAAGA GGAAGCGGAGCTACTAACTTCAGCCTGCTGAAGCAGGCTGGAGACGTGGAGGAGAACCCTGGACCT ATGACCGAGTACAAGCCCACGGTGCGCCTCGCCACCCGCGACGACGTCCCCAGGGCCGTACGCACCCTCGCCGCCGCGTTCGCCGACTACCCCGCCACGCGCCACACCGTCGATCCGGACCGCCACATCGAGCGGGTCACCGAGCTGCAAGAACTCTTCCTCACGCGCGTCGGGCTCGACATCGGCAAGGTGTGGGTCGCGGACGACGGCGCCGCGGTGGCGGTCTGGACCACGCCGGAGAGCGTCGAAGCGGGGGCGGTGTTCGCCGAGATCGGCCCGCGCATGGCCGAGTTGAGCGGTTCCCGGCTGGCCGCGCAGCAACAGATGGAAGGCCTCCTGGCGCCGCACCGGCCCAAGGAGCCCGCGTGGTTCCTGGCCACCGTCGGCGTCTCGCCCGACCACCAGGGCAAGGGTCTGGGCAGCGCCGTCGTGCTCCCCGGAGTGGAGGCGGCCGAGCGCGCCGGGGTGCCCGCCTTCCTGGAGACCTCCGCGCCCCGCAACCTCCCCTTCTACGAGCGGCTCGGCTTCACCGTCACCGCCGACGTCGAGGTGCCCGAAGGACCGCGCACCTGGTGCATGACCCGCAAGCCCGGTGCCTGA AACTTGTTTATTGCAGCTTATAATGGTTACAAATAAAGCAATAGCATCACAAATTTCACAAATAAAGCATTTTTTTCACTGCATTCTAGTTGTGGTTTGTCCAAACTCATCAATGTATCTTA ATAACTTCGTATAATGTATGCTATACGAAGTTAT

Reference Data
RefSeq NM_177231, NM_178220
Synonyms 1200006I17Rik; AW208571; G430100A01Rik
Summary Functions in regulating agonist-mediated G-protein coupled receptor (GPCR) signaling by mediating both receptor desensitization and resensitization processes. During homologous desensitization, beta-arrestins bind to the GPRK-phosphorylated receptor and sterically preclude its coupling to the cognate G-protein; the binding appears to require additional receptor determinants exposed only in the active receptor conformation. The beta-arrestins target many receptors for internalization by acting as endocytic adapters (CLASPs, clathrin-associated sorting proteins) and recruiting the GPRCs to the adapter protein 2 complex 2 (AP-2) in clathrin-coated pits (CCPs). However, the extent of beta-arrestin involvement appears to vary significantly depending on the receptor, agonist and cell type. Internalized arrestin-receptor complexes traffic to intracellular endosomes, where they remain uncoupled from G-proteins. Two different modes of arrestin-mediated internalization occur. Class A receptors, like ADRB2, OPRM1, ENDRA, D1AR and ADRA1B dissociate from beta-arrestin at or near the plasma membrane and undergo rapid recycling. Class B receptors, like AVPR2, AGTR1, NTSR1, TRHR and TACR1 internalize as a complex with arrestin and traffic with it to endosomal vesicles, presumably as desensitized receptors, for extended periods of time. Receptor resensitization then requires that receptor-bound arrestin is removed so that the receptor can be dephosphorylated and returned to the plasma membrane. Involved in internalization of P2RY4 and UTP-stimulated internalization of P2RY2. Involved in phosphorylation-dependent internalization of OPRD1 ands subsequent recycling. Involved in the degradation of cAMP by recruiting cAMP phosphodiesterases to ligand-activated receptors. Beta-arrestins function as multivalent adapter proteins that can switch the GPCR from a G-protein signaling mode that transmits short-lived signals from the plasma membrane via small molecule second messengers and ion channels to a beta-arrestin signaling mode that transmits a distinct set of signals that are initiated as the receptor internalizes and transits the intracellular compartment. Acts as signaling scaffold for MAPK pathways such as MAPK1/3 (ERK1/2). ERK1/2 activated by the beta-arrestin scaffold is largely excluded from the nucleus and confined to cytoplasmic locations such as endocytic vesicles, also called beta-arrestin signalosomes. Recruits c-Src/SRC to ADRB2 resulting in ERK activation. GPCRs for which the beta-arrestin-mediated signaling relies on both ARRB1 and ARRB2 (codependent regulation) include ADRB2, F2RL1 and PTH1R. For some GPCRs the beta-arrestin-mediated signaling relies on either ARRB1 or ARRB2 and is inhibited by the other respective beta-arrestin form (reciprocal regulation). Inhibits ERK1/2 signaling in AGTR1- and AVPR2-mediated activation (reciprocal regulation). Is required for SP-stimulated endocytosis of NK1R and recruits c-Src/SRC to internalized NK1R resulting in ERK1/2 activation, which is required for the antiapoptotic effects of SP. Is involved in proteinase-activated F2RL1-mediated ERK activity. Acts as signaling scaffold for the AKT1 pathway. Is involved in alpha-thrombin-stimulated AKT1 signaling. Is involved in IGF1-stimulated AKT1 signaling leading to increased protection from apoptosis. Involved in activation of the p38 MAPK signaling pathway and in actin bundle formation. Involved in F2RL1-mediated cytoskeletal rearrangement and chemotaxis. Involved in AGTR1-mediated stress fiber formation by acting together with GNAQ to activate RHOA. Appears to function as signaling scaffold involved in regulation of MIP-1-beta-stimulated CCR5-dependent chemotaxis. Involved in attenuation of NF-kappa-B-dependent transcription in response to GPCR or cytokine stimulation by interacting with and stabilizing CHUK. May serve as nuclear messenger for GPCRs. Involved in OPRD1-stimulated transcriptional regulation by translocating to CDKN1B and FOS promoter regions and recruiting EP300 resulting in acetyla
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Other Versions

Customer Reviews 
Loading...