Pdgfra Mouse Gene Knockout Kit (CRISPR)

CAT#: KN313036

Pdgfra - mouse gene knockout kit via CRISPR, HDR mediated




 HDR-mediated knockout kit validation

  See Other Versions

CNY 12260.00


货期*
6周

规格
    • 1 kit

Product images

推荐一起购买 (2)
pCAS-Scramble, pCas-Guide vector with a scrambled sequence as a negative control (10 µg)
    • 10 ug

CNY 3710.00


Pdgfra (tGFP-tagged) - Mouse platelet derived growth factor receptor, alpha polypeptide (Pdgfra), transcript variant 1
    • 10 ug

CNY 12976.00

Specifications

Product Data
Format 2 gRNA vectors, 1 GFP-puro donor, 1 scramble control
Donor DNA GFP-puro
Symbol Pdgfra
UniProt ID P26618
Locus ID 18595
Kit Components

KN313036G1, Pdgfra gRNA vector 1 in pCas-Guide CRISPR vector, Target Sequence: TGAGGACCAGAAAGACCTGG

KN313036G2, Pdgfra gRNA vector 2 in pCas-Guide CRISPR vector, Target Sequence: TGTGTGGATACATACCTGTG

KN313036-D, donor DNA containing left and right homologous arms and GFP-puro functional cassette.

GE100003, scramble sequence in pCas-Guide vector

Disclaimer These products are manufactured and supplied by OriGene under license from ERS. The kit is designed based on the best knowledge of CRISPR technology. The system has been functionally validated for knocking-in the cassette downstream the native promoter. The efficiency of the knock-out varies due to the nature of the biology and the complexity of the experimental process.
Reference Data
RefSeq NM_001083316, NM_011058, NR_144636
Synonyms AI115593; CD140a; Pdgfr-2
Summary This gene encodes a member of the receptor tyrosine kinase family of proteins. Binding of platelet-derived growth factor protein ligands to this receptor triggers receptor dimerization and autophosphorylation, resulting in the activation of several downstream signaling pathways. Signaling through the encoded receptor plays a role in gastrulation and the development of nearly all organ systems. Mice lacking a functional copy of this gene reportedly exhibit defects in lung, skeleton, testis and the central nervous system, and die soon after birth. Alternative splicing and intronic polyadenylation of gene transcripts have been implicated in muscle regeneration and fibrosis in adult mice. [provided by RefSeq, Jan 2017]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Other Versions

Customer Reviews 
Loading...