Dpp4 Mouse Gene Knockout Kit (CRISPR)
CAT#: KN304781
Dpp4 - mouse gene knockout kit via CRISPR, HDR mediated
HDR-mediated knockout kit validation
CNY 12260.00
Specifications
| Product Data | |
| Format | 2 gRNA vectors, 1 GFP-puro donor, 1 scramble control |
| Donor DNA | GFP-puro |
| Symbol | Dpp4 |
| UniProt ID | P28843 |
| Locus ID | 13482 |
| Kit Components |
KN304781G1, Dpp4 gRNA vector 1 in pCas-Guide CRISPR vector, Target Sequence: GGTTGCCTCCAGGAAAACTG KN304781G2, Dpp4 gRNA vector 2 in pCas-Guide CRISPR vector, Target Sequence: CCCGACCCTCTGGTCCAGGG KN304781-D, donor DNA containing left and right homologous arms and GFP-puro functional cassette. GE100003, scramble sequence in pCas-Guide vector |
| Disclaimer | These products are manufactured and supplied by OriGene under license from ERS. The kit is designed based on the best knowledge of CRISPR technology. The system has been functionally validated for knocking-in the cassette downstream the native promoter. The efficiency of the knock-out varies due to the nature of the biology and the complexity of the experimental process. |
| Reference Data | |
| RefSeq | NM_001159543, NM_010074 |
| Synonyms | Cd26; Dpp-4; THAM |
| Summary | Cell surface glycoprotein receptor involved in the costimulatory signal essential for T-cell receptor (TCR)-mediated T-cell activation. Acts as a positive regulator of T-cell coactivation, by binding at least ADA, CAV1, IGF2R, and PTPRC. Its binding to CAV1 and CARD11 induces T-cell proliferation and NF-kappa-B activation in a T-cell receptor/CD3-dependent manner. Its interaction with ADA also regulates lymphocyte-epithelial cell adhesion. In association with FAP is involved in the pericellular proteolysis of the extracellular matrix (ECM), the migration and invasion of endothelial cells into the ECM. May be involved in the promotion of lymphatic endothelial cells adhesion, migration and tube formation. When overexpressed, enhanced cell proliferation, a process inhibited by GPC3. Acts also as a serine exopeptidase with a dipeptidyl peptidase activity that regulates various physiological processes by cleaving peptides in the circulation, including many chemokines, mitogenic growth factors, neuropeptides and peptide hormones. Removes N-terminal dipeptides sequentially from polypeptides having unsubstituted N-termini provided that the penultimate residue is proline.[UniProtKB/Swiss-Prot Function] |
Documents
| Product Manuals |
| FAQs |
Resources
| 基因表达相关资源 |
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| KN304781BN | Dpp4 - mouse gene knockout kit via CRISPR, HDR mediated |
CNY 12260.00 |
|
| KN304781LP | Dpp4 - mouse gene knockout kit via CRISPR, HDR mediated |
CNY 12260.00 |
|
| KN304781RB | Dpp4 - mouse gene knockout kit via CRISPR, HDR mediated |
CNY 12260.00 |
|
| KN504781 | Dpp4 - KN2.0, Mouse gene knockout kit via CRISPR, non-homology mediated. |
CNY 8680.00 |
|
| GA201121 | Dpp4 CRISPRa kit - CRISPR gene activation of mouse dipeptidylpeptidase 4 |
CNY 12255.00 |
