Cdk5rap2 Mouse Gene Knockout Kit (CRISPR)

CAT#: KN303046

Cdk5rap2 - mouse gene knockout kit via CRISPR, HDR mediated




 HDR-mediated knockout kit validation

  See Other Versions

CNY 12260.00


货期*
6周

规格
    • 1 kit

Product images

推荐一起购买 (2)
pCAS-Scramble, pCas-Guide vector with a scrambled sequence as a negative control (10 µg)
    • 10 ug

CNY 3710.00


Cdk5rap2 (Myc-DDK-tagged) - Mouse CDK5 regulatory subunit associated protein 2 (Cdk5rap2)
    • 10 ug

CNY 12248.00

Specifications

Product Data
Format 2 gRNA vectors, 1 GFP-puro donor, 1 scramble control
Donor DNA GFP-puro
Symbol Cdk5rap2
Locus ID 214444
Kit Components

KN303046G1, Cdk5rap2 gRNA vector 1 in pCas-Guide CRISPR vector, Target Sequence: GACTCGGGGATGGAAGAGGA

KN303046G2, Cdk5rap2 gRNA vector 2 in pCas-Guide CRISPR vector, Target Sequence: GCCCTGCCTGGGACCCTCAG

KN303046-D, donor DNA containing left and right homologous arms and GFP-puro functional cassette.

GE100003, scramble sequence in pCas-Guide vector

Disclaimer These products are manufactured and supplied by OriGene under license from ERS. The kit is designed based on the best knowledge of CRISPR technology. The system has been functionally validated for knocking-in the cassette downstream the native promoter. The efficiency of the knock-out varies due to the nature of the biology and the complexity of the experimental process.
Reference Data
RefSeq NM_001313762, NM_145990
Synonyms 2900018K03Rik; an; mKIAA1633
Summary Potential regulator of CDK5 activity via its interaction with CDK5R1. Negative regulator of centriole disengagement (licensing) which maintains centriole engagement and cohesion (PubMed:20627074). Involved in regulation of mitotic spindle orientation (PubMed:20460369). Plays a role in the spindle checkpoint activation by acting as a transcriptional regulator of both BUBR1 and MAD2 promoter. Required for the recruitment of AKAP9 to centrosomes (By similarity). Plays a role in neurogenesis (PubMed:20471352). Contrary to higher mammalian orthologs, including human, chimpanzee, bovine and dog, does not interact with EB1/MAPRE1, therefore its function in the regulation of microtubule dynamics is unclear (PubMed:19553473).[UniProtKB/Swiss-Prot Function]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Other Versions

Customer Reviews 
Loading...