Cdk5rap2 Mouse Gene Knockout Kit (CRISPR)
CAT#: KN303046
Cdk5rap2 - mouse gene knockout kit via CRISPR, HDR mediated
HDR-mediated knockout kit validation
CNY 12260.00
Specifications
Product Data | |
Format | 2 gRNA vectors, 1 GFP-puro donor, 1 scramble control |
Donor DNA | GFP-puro |
Symbol | Cdk5rap2 |
Locus ID | 214444 |
Kit Components |
KN303046G1, Cdk5rap2 gRNA vector 1 in pCas-Guide CRISPR vector, Target Sequence: GACTCGGGGATGGAAGAGGA KN303046G2, Cdk5rap2 gRNA vector 2 in pCas-Guide CRISPR vector, Target Sequence: GCCCTGCCTGGGACCCTCAG KN303046-D, donor DNA containing left and right homologous arms and GFP-puro functional cassette. GE100003, scramble sequence in pCas-Guide vector |
Disclaimer | These products are manufactured and supplied by OriGene under license from ERS. The kit is designed based on the best knowledge of CRISPR technology. The system has been functionally validated for knocking-in the cassette downstream the native promoter. The efficiency of the knock-out varies due to the nature of the biology and the complexity of the experimental process. |
Reference Data | |
RefSeq | NM_001313762, NM_145990 |
Synonyms | 2900018K03Rik; an; mKIAA1633 |
Summary | Potential regulator of CDK5 activity via its interaction with CDK5R1. Negative regulator of centriole disengagement (licensing) which maintains centriole engagement and cohesion (PubMed:20627074). Involved in regulation of mitotic spindle orientation (PubMed:20460369). Plays a role in the spindle checkpoint activation by acting as a transcriptional regulator of both BUBR1 and MAD2 promoter. Required for the recruitment of AKAP9 to centrosomes (By similarity). Plays a role in neurogenesis (PubMed:20471352). Contrary to higher mammalian orthologs, including human, chimpanzee, bovine and dog, does not interact with EB1/MAPRE1, therefore its function in the regulation of microtubule dynamics is unclear (PubMed:19553473).[UniProtKB/Swiss-Prot Function] |
Documents
Product Manuals |
FAQs |
Resources
基因表达相关资源 |
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
KN303046BN | Cdk5rap2 - mouse gene knockout kit via CRISPR, HDR mediated |
CNY 12260.00 |
|
KN303046LP | Cdk5rap2 - mouse gene knockout kit via CRISPR, HDR mediated |
CNY 12260.00 |
|
KN303046RB | Cdk5rap2 - mouse gene knockout kit via CRISPR, HDR mediated |
CNY 12260.00 |
|
KN503046 | Cdk5rap2 - KN2.0, Mouse gene knockout kit via CRISPR, non-homology mediated. |
CNY 8680.00 |
|
GA213212 | Cdk5rap2 CRISPRa kit - CRISPR gene activation of mouse CDK5 regulatory subunit associated protein 2 |
CNY 12255.00 |
其它Cdk5rap2产品