IL28 Receptor alpha (IFNLR1) Human Gene Knockout Kit (CRISPR)

CAT#: KN221789

IFNLR1 - human gene knockout kit via CRISPR, HDR mediated




 HDR-mediated knockout kit validation

  See Other Versions

CNY 12260.00


货期*
6周

规格
    • 1 kit

Product images

推荐一起购买 (3)
pCAS-Scramble, pCas-Guide vector with a scrambled sequence as a negative control (10 µg)
    • 10 ug

CNY 3710.00


IFNLR1 mouse monoclonal antibody,clone OTI8G1
    • 100 ul

CNY 1999.00
CNY 2700.00


IFNLR1 (Myc-DDK-tagged)-Human interleukin 28 receptor, alpha (interferon, lambda receptor) (IL28RA), transcript variant 2
    • 10 ug

CNY 3656.00
CNY 4280.00

Specifications

Product Data
Format 2 gRNA vectors, 1 GFP-puro donor, 1 scramble control
Donor DNA GFP-puro
Symbol IL28 Receptor alpha
UniProt ID Q8IU57
Locus ID 163702
Kit Components

KN221789G1, IL28 Receptor alpha gRNA vector 1 in pCas-Guide CRISPR vector, Target Sequence: CCGCTCCAGGTAAGGGCGCG

KN221789G2, IL28 Receptor alpha gRNA vector 2 in pCas-Guide CRISPR vector, Target Sequence: TACCTGGAGCGGCCTGCAGC

KN221789-D, donor DNA containing left and right homologous arms and GFP-puro functional cassette.

GE100003, scramble sequence in pCas-Guide vector

Disclaimer These products are manufactured and supplied by OriGene under license from ERS. The kit is designed based on the best knowledge of CRISPR technology. The system has been functionally validated for knocking-in the cassette downstream the native promoter. The efficiency of the knock-out varies due to the nature of the biology and the complexity of the experimental process.
Reference Data
RefSeq NM_170743, NM_173064, NM_173065
Synonyms CRF2/12; IFNLR; IL-28R1; IL28RA; LICR2
Summary The protein encoded by this gene belongs to the class II cytokine receptor family. This protein forms a receptor complex with interleukine 10 receptor, beta (IL10RB). The receptor complex has been shown to interact with three closely related cytokines, including interleukin 28A (IL28A), interleukin 28B (IL28B), and interleukin 29 (IL29). The expression of all three cytokines can be induced by viral infection. The cells overexpressing this protein have been found to have enhanced responses to IL28A and IL29, but decreased response to IL28B. Three alternatively spliced transcript variants encoding distinct isoforms have been reported. [provided by RefSeq, Jul 2008]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Other Versions

Customer Reviews 
Loading...