Interferon beta (IFNB1) Human Gene Knockout Kit (CRISPR)
CAT#: KN218565
IFNB1 - human gene knockout kit via CRISPR, HDR mediated
HDR-mediated knockout kit validation
CNY 12260.00
Specifications
Product Data | |
Format | 2 gRNA vectors, 1 GFP-puro donor, 1 scramble control |
Donor DNA | GFP-puro |
Symbol | Interferon beta |
Locus ID | 3456 |
Kit Components |
KN218565G1, Interferon beta gRNA vector 1 in pCas-Guide CRISPR vector, Target Sequence: AATTTGGAGGAGACACTTGT KN218565G2, Interferon beta gRNA vector 2 in pCas-Guide CRISPR vector, Target Sequence: TCCAAGCAAGTTGTAGCTCA KN218565-D, donor DNA containing left and right homologous arms and GFP-puro functional cassette. GE100003, scramble sequence in pCas-Guide vector |
Disclaimer | These products are manufactured and supplied by OriGene under license from ERS. The kit is designed based on the best knowledge of CRISPR technology. The system has been functionally validated for knocking-in the cassette downstream the native promoter. The efficiency of the knock-out varies due to the nature of the biology and the complexity of the experimental process. |
Reference Data | |
RefSeq | NM_002176 |
Synonyms | IFB; IFF; IFNB |
Summary | This gene encodes a cytokine that belongs to the interferon family of signaling proteins, which are released as part of the innate immune response to pathogens. The protein encoded by this gene belongs to the type I class of interferons, which are important for defense against viral infections. In addition, type I interferons are involved in cell differentiation and anti-tumor defenses. Following secretion in response to a pathogen, type I interferons bind a homologous receptor complex and induce transcription of genes such as those encoding inflammatory cytokines and chemokines. Overactivation of type I interferon secretion is linked to autoimmune diseases. Mice deficient for this gene display several phenotypes including defects in B cell maturation and increased susceptibility to viral infection. [provided by RefSeq, Sep 2015] |
Documents
Product Manuals |
FAQs |
Resources
基因表达相关资源 |
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
KN218565BN | IFNB1 - human gene knockout kit via CRISPR, HDR mediated |
CNY 12260.00 |
|
KN218565LP | IFNB1 - human gene knockout kit via CRISPR, HDR mediated |
CNY 12260.00 |
|
KN218565RB | IFNB1 - human gene knockout kit via CRISPR, HDR mediated |
CNY 12260.00 |
|
KN418565 | IFNB1 - KN2.0, Human gene knockout kit via CRISPR, non-homology mediated. |
CNY 8680.00 |
|
GA102341 | IFNB1 CRISPRa kit - CRISPR gene activation of human interferon beta 1 |
CNY 12255.00 |
其它Interferon beta产品