MRP5 (ABCC5) Human Gene Knockout Kit (CRISPR)

CAT#: KN217669

ABCC5 - human gene knockout kit via CRISPR, HDR mediated




 HDR-mediated knockout kit validation

  See Other Versions

CNY 12260.00


货期*
6周

规格
    • 1 kit

Product images

推荐一起购买 (3)
pCAS-Scramble, pCas-Guide vector with a scrambled sequence as a negative control (10 µg)
    • 10 ug

CNY 3710.00


ABCC5 mouse monoclonal antibody, clone OTI2C8 (formerly 2C8)
    • 100 ul

CNY 1999.00
CNY 2700.00


ABCC5 (Myc-DDK-tagged)-Human ATP-binding cassette, sub-family C (CFTR/MRP), member 5 (ABCC5), transcript variant 2
    • 10 ug

CNY 3600.00

Specifications

Product Data
Format 2 gRNA vectors, 1 GFP-puro donor, 1 scramble control
Donor DNA GFP-puro
Symbol MRP5
Locus ID 10057
Kit Components

KN217669G1, MRP5 gRNA vector 1 in pCas-Guide CRISPR vector, Target Sequence: GTCCTGGGTATAGAAGTGTG

KN217669G2, MRP5 gRNA vector 2 in pCas-Guide CRISPR vector, Target Sequence: TCTTAGGAAAGGAAACTGAC

KN217669-D, donor DNA containing left and right homologous arms and GFP-puro functional cassette.

GE100003, scramble sequence in pCas-Guide vector

Disclaimer These products are manufactured and supplied by OriGene under license from ERS. The kit is designed based on the best knowledge of CRISPR technology. The system has been functionally validated for knocking-in the cassette downstream the native promoter. The efficiency of the knock-out varies due to the nature of the biology and the complexity of the experimental process.
Reference Data
RefSeq NM_001023587, NM_001320032, NM_005688, NR_135125
Synonyms ABC33; EST277145; MOAT-C; MOATC; MRP5; pABC11; SMRP
Summary The protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intra-cellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the MRP subfamily which is involved in multi-drug resistance. This protein functions in the cellular export of its substrate, cyclic nucleotides. This export contributes to the degradation of phosphodiesterases and possibly an elimination pathway for cyclic nucleotides. Studies show that this protein provides resistance to thiopurine anticancer drugs, 6-mercatopurine and thioguanine, and the anti-HIV drug 9-(2-phosphonylmethoxyethyl)adenine. This protein may be involved in resistance to thiopurines in acute lymphoblastic leukemia and antiretroviral nucleoside analogs in HIV-infected patients. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2016]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Other Versions

Customer Reviews 
Loading...