CA150 (TCERG1) Human Gene Knockout Kit (CRISPR)

CAT#: KN217192

TCERG1 - human gene knockout kit via CRISPR, HDR mediated




 HDR-mediated knockout kit validation

  See Other Versions

CNY 12260.00


货期*
4周

规格
    • 1 kit

Cited in 1 publication.

Product images

推荐一起购买 (3)
pCAS-Scramble, pCas-Guide vector with a scrambled sequence as a negative control (10 µg)
    • 10 ug

CNY 3710.00


Rabbit Polyclonal Anti-TCERG1 Antibody
    • 100 ul

CNY 5250.00


TCERG1 (Myc-DDK-tagged)-Human transcription elongation regulator 1 (TCERG1), transcript variant 2
    • 10 ug

CNY 7496.00

Specifications

Product Data
Format 2 gRNA vectors, 1 GFP-puro donor, 1 scramble control
Donor DNA GFP-puro
Symbol CA150
UniProt ID O14776
Locus ID 10915
Kit Components

KN217192G1, CA150 gRNA vector 1 in pCas-Guide CRISPR vector, Target Sequence: GAGTGAACGATTCAACCCGG

KN217192G2, CA150 gRNA vector 2 in pCas-Guide CRISPR vector, Target Sequence: TCTCGTGAGCAGAGATGTGA

KN217192-D, donor DNA containing left and right homologous arms and GFP-puro functional cassette.

GE100003, scramble sequence in pCas-Guide vector

Disclaimer These products are manufactured and supplied by OriGene under license from ERS. The kit is designed based on the best knowledge of CRISPR technology. The system has been functionally validated for knocking-in the cassette downstream the native promoter. The efficiency of the knock-out varies due to the nature of the biology and the complexity of the experimental process.
Reference Data
RefSeq NM_001040006, NM_006706
Synonyms CA150; TAF2S; Urn1
Summary This gene encodes a nuclear protein that regulates transcriptional elongation and pre-mRNA splicing. The encoded protein interacts with the hyperphosphorylated C-terminal domain of RNA polymerase II via multiple FF domains, and with the pre-mRNA splicing factor SF1 via a WW domain. Alternative splicing results in multiple transcripts variants encoding different isoforms. [provided by RefSeq, Jul 2008]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Citations (1)

Documents

Other Versions

Customer Reviews 
Loading...