CA150 (TCERG1) Human Gene Knockout Kit (CRISPR)
CAT#: KN217192
TCERG1 - human gene knockout kit via CRISPR, HDR mediated
HDR-mediated knockout kit validation
CNY 12260.00
Cited in 1 publication. |
Specifications
Product Data | |
Format | 2 gRNA vectors, 1 GFP-puro donor, 1 scramble control |
Donor DNA | GFP-puro |
Symbol | CA150 |
UniProt ID | O14776 |
Locus ID | 10915 |
Kit Components |
KN217192G1, CA150 gRNA vector 1 in pCas-Guide CRISPR vector, Target Sequence: GAGTGAACGATTCAACCCGG KN217192G2, CA150 gRNA vector 2 in pCas-Guide CRISPR vector, Target Sequence: TCTCGTGAGCAGAGATGTGA KN217192-D, donor DNA containing left and right homologous arms and GFP-puro functional cassette. GE100003, scramble sequence in pCas-Guide vector |
Disclaimer | These products are manufactured and supplied by OriGene under license from ERS. The kit is designed based on the best knowledge of CRISPR technology. The system has been functionally validated for knocking-in the cassette downstream the native promoter. The efficiency of the knock-out varies due to the nature of the biology and the complexity of the experimental process. |
Reference Data | |
RefSeq | NM_001040006, NM_006706 |
Synonyms | CA150; TAF2S; Urn1 |
Summary | This gene encodes a nuclear protein that regulates transcriptional elongation and pre-mRNA splicing. The encoded protein interacts with the hyperphosphorylated C-terminal domain of RNA polymerase II via multiple FF domains, and with the pre-mRNA splicing factor SF1 via a WW domain. Alternative splicing results in multiple transcripts variants encoding different isoforms. [provided by RefSeq, Jul 2008] |
Citations (1)
The use of this Gene Expression has been cited in the following citations: |
---|
Role for the splicing factor TCERG1 in Cajal body integrity and snRNP assembly.
,null,
Journal of cell science
,PubMed ID 31636114
[CA150]
|
Documents
Product Manuals |
FAQs |
Resources
基因表达相关资源 |
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
KN217192BN | TCERG1 - human gene knockout kit via CRISPR, HDR mediated |
CNY 12260.00 |
|
KN217192LP | TCERG1 - human gene knockout kit via CRISPR, HDR mediated |
CNY 12260.00 |
|
KN217192RB | TCERG1 - human gene knockout kit via CRISPR, HDR mediated |
CNY 12260.00 |
|
KN417192 | TCERG1 - KN2.0, Human gene knockout kit via CRISPR, non-homology mediated. |
CNY 8680.00 |
|
GA107484 | TCERG1 CRISPRa kit - CRISPR gene activation of human transcription elongation regulator 1 |
CNY 12255.00 |