CrkRS (CDK12) Human Gene Knockout Kit (CRISPR)
CAT#: KN213898
CDK12 - human gene knockout kit via CRISPR, HDR mediated
HDR-mediated knockout kit validation
CNY 11400.00
Specifications
Product Data | |
Format | 2 gRNA vectors, 1 GFP-puro donor, 1 scramble control |
Symbol | CrkRS |
Locus ID | 51755 |
Kit Components |
KN213898G1, CrkRS gRNA vector 1 in pCas-Guide CRISPR vector, Target Sequence: GGTCACCAACCCCATGTCTT KN213898G2, CrkRS gRNA vector 2 in pCas-Guide CRISPR vector, Target Sequence: TGTGCCCAGGGATGCTGCTT KN213898-D, donor DNA containing left and right homologous arms and functional cassette. GE100003, scramble sequence in pCas-Guide vector |
Disclaimer | These products are manufactured and supplied by OriGene under license from ERS. The kit is designed based on the best knowledge of CRISPR technology. The system has been functionally validated for knocking-in the cassette downstream the native promoter. The efficiency of the knock-out varies due to the nature of the biology and the complexity of the experimental process. |
Reference Data | |
RefSeq | NM_015083, NM_016507 |
Synonyms | CRK7; CRKR; CRKRS |
Summary | Cyclin-dependent kinase that phosphorylates the C-terminal domain (CTD) of the large subunit of RNA polymerase II (POLR2A), thereby acting as a key regulator of transcription elongation. Regulates the expression of genes involved in DNA repair and is required for the maintenance of genomic stability. Preferentially phosphorylates 'Ser-5' in CTD repeats that are already phosphorylated at 'Ser-7', but can also phosphorylate 'Ser-2'. Required for RNA splicing, possibly by phosphorylating SRSF1/SF2. Involved in regulation of MAP kinase activity, possibly leading to affect the response to estrogen inhibitors.[UniProtKB/Swiss-Prot Function] |
Documents
Product Manuals |
FAQs |
Resources
基因表达相关资源 |