LIN28B Human Gene Knockout Kit (CRISPR)

CAT#: KN213537

LIN28B - human gene knockout kit via CRISPR, HDR mediated




 HDR-mediated knockout kit validation

  See Other Versions

CNY 12260.00


货期*
4周

规格
    • 1 kit

Product images

推荐一起购买 (3)
pCAS-Scramble, pCas-Guide vector with a scrambled sequence as a negative control (10 µg)
    • 10 ug

CNY 3710.00


Rabbit polyclonal LIN28B Antibody (N-term)
    • 400 ul

CNY 6314.00


LIN28B (Myc-DDK-tagged)-Human lin-28 homolog B (C. elegans) (LIN28B)
    • 10 ug

CNY 3600.00
CNY 3705.00

Specifications

Product Data
Format 2 gRNA vectors, 1 GFP-puro donor, 1 scramble control
Donor DNA GFP-puro
Symbol LIN28B
UniProt ID Q6ZN17
Locus ID 389421
Kit Components

KN213537G1, LIN28B gRNA vector 1 in pCas-Guide CRISPR vector, Target Sequence: CCGTGGGGCAACATGGCCGA

KN213537G2, LIN28B gRNA vector 2 in pCas-Guide CRISPR vector, Target Sequence: TAGAAAAGAAAATTAACCTT

KN213537-D, donor DNA containing left and right homologous arms and GFP-puro functional cassette.

GE100003, scramble sequence in pCas-Guide vector

Disclaimer These products are manufactured and supplied by OriGene under license from ERS. The kit is designed based on the best knowledge of CRISPR technology. The system has been functionally validated for knocking-in the cassette downstream the native promoter. The efficiency of the knock-out varies due to the nature of the biology and the complexity of the experimental process.
Reference Data
RefSeq NM_001004317
Synonyms CSDD2
Summary The protein encoded by this gene belongs to the lin-28 family, which is characterized by the presence of a cold-shock domain and a pair of CCHC zinc finger domains. This gene is highly expressed in testis, fetal liver, placenta, and in primary human tumors and cancer cell lines. It is negatively regulated by microRNAs that target sites in the 3' UTR, and overexpression of this gene in primary tumors is linked to the repression of let-7 family of microRNAs and derepression of let-7 targets, which facilitates cellular transformation. [provided by RefSeq, Jun 2012]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Other Versions

Customer Reviews 
Loading...