CNOT7 Human Gene Knockout Kit (CRISPR)
CAT#: KN209293
CNOT7 - human gene knockout kit via CRISPR, HDR mediated
HDR-mediated knockout kit validation
CNY 12260.00
CNY 3710.00
CNY 2400.00
CNY 3990.00
Specifications
| Product Data | |
| Format | 2 gRNA vectors, 1 GFP-puro donor, 1 scramble control |
| Donor DNA | GFP-puro |
| Symbol | CNOT7 |
| UniProt ID | Q9UIV1 |
| Locus ID | 29883 |
| Kit Components |
KN209293G1, CNOT7 gRNA vector 1 in pCas-Guide CRISPR vector, Target Sequence: TAAAACGCTTCATATAAAGG KN209293G2, CNOT7 gRNA vector 2 in pCas-Guide CRISPR vector, Target Sequence: AGTCTTGAATTCAACCCTTT KN209293-D, donor DNA containing left and right homologous arms and GFP-puro functional cassette. GE100003, scramble sequence in pCas-Guide vector |
| Disclaimer | These products are manufactured and supplied by OriGene under license from ERS. The kit is designed based on the best knowledge of CRISPR technology. The system has been functionally validated for knocking-in the cassette downstream the native promoter. The efficiency of the knock-out varies due to the nature of the biology and the complexity of the experimental process. |
| Reference Data | |
| RefSeq | NM_013354, NM_054026, NM_001322087, NM_001322088, NM_001322089, NM_001322090, NM_001322091, NM_001322092, NM_001322093, NM_001322094, NM_001322095, NM_001322096, NM_001322097, NM_001322098, NM_001322099, NM_001322100 |
| Synonyms | CAF1; Caf1a; hCAF-1 |
| Summary | The protein encoded by this gene binds to an anti-proliferative protein, B-cell translocation protein 1, which negatively regulates cell proliferation. Binding of the two proteins, which is driven by phosphorylation of the anti-proliferative protein, causes signaling events in cell division that lead to changes in cell proliferation associated with cell-cell contact. The encoded protein downregulates the innate immune response and therefore provides a therapeutic target for enhancing its antimicrobial activity against foreign agents. Alternative splicing of this gene results in multiple transcript variants. Related pseudogenes have been identified on chromosomes 1 and X. [provided by RefSeq, Apr 2016] |
Documents
| Product Manuals |
| FAQs |
Resources
| 基因表达相关资源 |
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| KN209293BN | CNOT7 - human gene knockout kit via CRISPR, HDR mediated |
CNY 12260.00 |
|
| KN209293LP | CNOT7 - human gene knockout kit via CRISPR, HDR mediated |
CNY 12260.00 |
|
| KN209293RB | CNOT7 - human gene knockout kit via CRISPR, HDR mediated |
CNY 12260.00 |
|
| KN409293 | CNOT7 - KN2.0, Human gene knockout kit via CRISPR, non-homology mediated. |
CNY 8680.00 |
|
| GA109288 | CNOT7 CRISPRa kit - CRISPR gene activation of human CCR4-NOT transcription complex subunit 7 |
CNY 12255.00 |
