SOX9 Human Gene Knockout Kit (CRISPR)

Specifications

Product Data
Format	2 gRNA vectors, 1 Luciferase-Puro donor, 1 scramble control
Donor DNA	Luciferase-Puro
Symbol	SOX9
Locus ID	6662
Kit Components	KN208944G1, SOX9 gRNA vector 1 in pCas-Guide CRISPR vector, Target Sequence: GCTCGGACACCGAGAACACG KN208944G2, SOX9 gRNA vector 2 in pCas-Guide CRISPR vector, Target Sequence: TCTGAAGAAGGAGAGCGAGG KN208944LP-D, donor DNA containing left and right homologous arms and Luciferase-Puro functional cassette. GE100003, scramble sequence in pCas-Guide vector
Disclaimer	These products are manufactured and supplied by OriGene under license from ERS. The kit is designed based on the best knowledge of CRISPR technology. The system has been functionally validated for knocking-in the cassette downstream the native promoter. The efficiency of the knock-out varies due to the nature of the biology and the complexity of the experimental process.
Reference Data
RefSeq	NM_000346
Synonyms	CMD1; CMPD1; SRA1; SRXX2; SRXY10
Summary	The protein encoded by this gene recognizes the sequence CCTTGAG along with other members of the HMG-box class DNA-binding proteins. It acts during chondrocyte differentiation and, with steroidogenic factor 1, regulates transcription of the anti-Muellerian hormone (AMH) gene. Deficiencies lead to the skeletal malformation syndrome campomelic dysplasia, frequently with sex reversal. [provided by RefSeq, Jul 2008]

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.