CYBB Human Gene Knockout Kit (CRISPR)

Specifications

Product Data
Format	2 gRNA vectors, 1 mBFP-Neo donor, 1 scramble control
Donor DNA	mBFP-Neo
Symbol	CYBB
UniProt ID	P04839
Locus ID	1536
Kit Components	KN207544G1, CYBB gRNA vector 1 in pCas-Guide CRISPR vector, Target Sequence: CTGACTTCTCGGGGTTATCT KN207544G2, CYBB gRNA vector 2 in pCas-Guide CRISPR vector, Target Sequence: GGGAACTGGGCTGTGAATGA KN207544BN-D, donor DNA containing left and right homologous arms and mBFP-Neo functional cassette. GE100003, scramble sequence in pCas-Guide vector
Reference Data
RefSeq	NM_000397
Synonyms	AMCBX2; CGD; GP91-1; GP91-PHOX; GP91PHOX; IMD34; NOX2; p91-PHOX
Summary	Cytochrome b (-245) is composed of cytochrome b alpha (CYBA) and beta (CYBB) chain. It has been proposed as a primary component of the microbicidal oxidase system of phagocytes. CYBB deficiency is one of five described biochemical defects associated with chronic granulomatous disease (CGD). In this disorder, there is decreased activity of phagocyte NADPH oxidase; neutrophils are able to phagocytize bacteria but cannot kill them in the phagocytic vacuoles. The cause of the killing defect is an inability to increase the cell's respiration and consequent failure to deliver activated oxygen into the phagocytic vacuole. [provided by RefSeq, Jul 2008]

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.