AXL Human Gene Knockout Kit (CRISPR)

CAT#: KN206431

AXL - human gene knockout kit via CRISPR, HDR mediated




 HDR-mediated knockout kit validation

  See Other Versions

CNY 12260.00


货期*
6周

规格
    • 1 kit

Product images

推荐一起购买 (3)
pCAS-Scramble, pCas-Guide vector with a scrambled sequence as a negative control (10 µg)
    • 10 ug

CNY 3710.00


Axl Rabbit polyclonal Antibody
    • 100 ul

CNY 1999.00
CNY 3280.00


AXL (Myc-DDK-tagged)-Human AXL receptor tyrosine kinase (AXL), transcript variant 1
    • 10 ug

CNY 6552.00

Specifications

Product Data
Format 2 gRNA vectors, 1 GFP-puro donor, 1 scramble control
Donor DNA GFP-puro
Symbol AXL
Locus ID 558
Kit Components

KN206431G1, AXL gRNA vector 1 in pCas-Guide CRISPR vector, Target Sequence: GTGCTTGGCGCTGTGCGGCT

KN206431G2, AXL gRNA vector 2 in pCas-Guide CRISPR vector, Target Sequence: TGGGCGTGCATGGCCCCCAG

KN206431-D, donor DNA containing left and right homologous arms and GFP-puro functional cassette.

GE100003, scramble sequence in pCas-Guide vector

Disclaimer These products are manufactured and supplied by OriGene under license from ERS. The kit is designed based on the best knowledge of CRISPR technology. The system has been functionally validated for knocking-in the cassette downstream the native promoter. The efficiency of the knock-out varies due to the nature of the biology and the complexity of the experimental process.
Reference Data
RefSeq NM_001278599, NM_001699, NM_021913
Synonyms ARK; JTK11; Tyro7; UFO
Summary The protein encoded by this gene is a member of the Tyro3-Axl-Mer (TAM) receptor tyrosine kinase subfamily. The encoded protein possesses an extracellular domain which is composed of two immunoglobulin-like motifs at the N-terminal, followed by two fibronectin type-III motifs. It transduces signals from the extracellular matrix into the cytoplasm by binding to the vitamin K-dependent protein growth arrest-specific 6 (Gas6). This gene may be involved in several cellular functions including growth, migration, aggregation and anti-inflammation in multiple cell types. Alternative splicing results in multiple transcript variants of this gene. [provided by RefSeq, Jul 2013]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Other Versions

Customer Reviews 
Loading...