AXL Human Gene Knockout Kit (CRISPR)
CAT#: KN206431
AXL - human gene knockout kit via CRISPR, HDR mediated
HDR-mediated knockout kit validation
CNY 12260.00
Specifications
Product Data | |
Format | 2 gRNA vectors, 1 GFP-puro donor, 1 scramble control |
Donor DNA | GFP-puro |
Symbol | AXL |
UniProt ID | P30530 |
Locus ID | 558 |
Kit Components |
KN206431G1, AXL gRNA vector 1 in pCas-Guide CRISPR vector, Target Sequence: GTGCTTGGCGCTGTGCGGCT KN206431G2, AXL gRNA vector 2 in pCas-Guide CRISPR vector, Target Sequence: TGGGCGTGCATGGCCCCCAG KN206431-D, donor DNA containing left and right homologous arms and GFP-puro functional cassette. GE100003, scramble sequence in pCas-Guide vector |
Disclaimer | These products are manufactured and supplied by OriGene under license from ERS. The kit is designed based on the best knowledge of CRISPR technology. The system has been functionally validated for knocking-in the cassette downstream the native promoter. The efficiency of the knock-out varies due to the nature of the biology and the complexity of the experimental process. |
Reference Data | |
RefSeq | NM_001278599, NM_001699, NM_021913 |
Synonyms | ARK; JTK11; Tyro7; UFO |
Summary | The protein encoded by this gene is a member of the Tyro3-Axl-Mer (TAM) receptor tyrosine kinase subfamily. The encoded protein possesses an extracellular domain which is composed of two immunoglobulin-like motifs at the N-terminal, followed by two fibronectin type-III motifs. It transduces signals from the extracellular matrix into the cytoplasm by binding to the vitamin K-dependent protein growth arrest-specific 6 (Gas6). This gene may be involved in several cellular functions including growth, migration, aggregation and anti-inflammation in multiple cell types. Alternative splicing results in multiple transcript variants of this gene. [provided by RefSeq, Jul 2013] |
Documents
Product Manuals |
FAQs |
Resources
基因表达相关资源 |
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
KN206431BN | AXL - human gene knockout kit via CRISPR, HDR mediated |
CNY 12260.00 |
|
KN206431LP | AXL - human gene knockout kit via CRISPR, HDR mediated |
CNY 12260.00 |
|
KN206431RB | AXL - human gene knockout kit via CRISPR, HDR mediated |
CNY 12260.00 |
|
KN406431 | AXL - KN2.0, Human gene knockout kit via CRISPR, non-homology mediated. |
CNY 8680.00 |
|
GA100385 | AXL CRISPRa kit - CRISPR gene activation of human AXL receptor tyrosine kinase |
CNY 12255.00 |