MAT1A Human Gene Knockout Kit (CRISPR)
CAT#: KN203765
MAT1A - human gene knockout kit via CRISPR, HDR mediated
HDR-mediated knockout kit validation
CNY 12260.00
Specifications
Product Data | |
Format | 2 gRNA vectors, 1 GFP-puro donor, 1 scramble control |
Donor DNA | GFP-puro |
Symbol | MAT1A |
Locus ID | 4143 |
Kit Components |
KN203765G1, MAT1A gRNA vector 1 in pCas-Guide CRISPR vector KN203765G2, MAT1A gRNA vector 2 in pCas-Guide CRISPR vector, Target Sequence: AGACTCCTTCACTTAGAGAG KN203765-D, donor DNA containing left and right homologous arms and GFP-puro functional cassette. GE100003, scramble sequence in pCas-Guide vector |
Disclaimer | These products are manufactured and supplied by OriGene under license from ERS. The kit is designed based on the best knowledge of CRISPR technology. The system has been functionally validated for knocking-in the cassette downstream the native promoter. The efficiency of the knock-out varies due to the nature of the biology and the complexity of the experimental process. |
Reference Data | |
RefSeq | NM_000429 |
Synonyms | MAT; MATA1; SAMS; SAMS1 |
Summary | This gene catalyzes a two-step reaction that involves the transfer of the adenosyl moiety of ATP to methionine to form S-adenosylmethionine and tripolyphosphate, which is subsequently cleaved to PPi and Pi. S-adenosylmethionine is the source of methyl groups for most biological methylations. The encoded protein is found as a homotetramer (MAT I) or a homodimer (MAT III) whereas a third form, MAT II (gamma), is encoded by the MAT2A gene. Mutations in this gene are associated with methionine adenosyltransferase deficiency. [provided by RefSeq, Jul 2008] |
Documents
Product Manuals |
FAQs |
Resources
基因表达相关资源 |
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
KN203765BN | MAT1A - human gene knockout kit via CRISPR, HDR mediated |
CNY 12260.00 |
|
KN203765LP | MAT1A - human gene knockout kit via CRISPR, HDR mediated |
CNY 12260.00 |
|
KN203765RB | MAT1A - human gene knockout kit via CRISPR, HDR mediated |
CNY 12260.00 |
|
KN403765 | MAT1A - KN2.0, Human gene knockout kit via CRISPR, non-homology mediated. |
CNY 8680.00 |
|
GA102821 | MAT1A CRISPRa kit - CRISPR gene activation of human methionine adenosyltransferase 1A |
CNY 12255.00 |