MAT1A Human Gene Knockout Kit (CRISPR)

CAT#: KN203765

MAT1A - human gene knockout kit via CRISPR, HDR mediated




 HDR-mediated knockout kit validation

  See Other Versions

CNY 12260.00


货期*
6周

规格
    • 1 kit

Product images

推荐一起购买 (3)
pCAS-Scramble, pCas-Guide vector with a scrambled sequence as a negative control (10 µg)
    • 10 ug

CNY 3710.00


Rabbit Polyclonal Anti-MAT1A Antibody
    • 100 ug

CNY 4537.00


MAT1A (Myc-DDK-tagged)-Human methionine adenosyltransferase I, alpha (MAT1A)
    • 10 ug

CNY 3656.00
CNY 3990.00

Specifications

Product Data
Format 2 gRNA vectors, 1 GFP-puro donor, 1 scramble control
Donor DNA GFP-puro
Symbol MAT1A
Locus ID 4143
Kit Components

KN203765G1, MAT1A gRNA vector 1 in pCas-Guide CRISPR vector

KN203765G2, MAT1A gRNA vector 2 in pCas-Guide CRISPR vector, Target Sequence: AGACTCCTTCACTTAGAGAG

KN203765-D, donor DNA containing left and right homologous arms and GFP-puro functional cassette.

GE100003, scramble sequence in pCas-Guide vector

Disclaimer These products are manufactured and supplied by OriGene under license from ERS. The kit is designed based on the best knowledge of CRISPR technology. The system has been functionally validated for knocking-in the cassette downstream the native promoter. The efficiency of the knock-out varies due to the nature of the biology and the complexity of the experimental process.
Reference Data
RefSeq NM_000429
Synonyms MAT; MATA1; SAMS; SAMS1
Summary This gene catalyzes a two-step reaction that involves the transfer of the adenosyl moiety of ATP to methionine to form S-adenosylmethionine and tripolyphosphate, which is subsequently cleaved to PPi and Pi. S-adenosylmethionine is the source of methyl groups for most biological methylations. The encoded protein is found as a homotetramer (MAT I) or a homodimer (MAT III) whereas a third form, MAT II (gamma), is encoded by the MAT2A gene. Mutations in this gene are associated with methionine adenosyltransferase deficiency. [provided by RefSeq, Jul 2008]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Other Versions

Customer Reviews 
Loading...