GAPDH Human Gene Knockout Kit (CRISPR)

CAT#: KN202309BN

GAPDH - human gene knockout kit via CRISPR, HDR mediated




 HDR-mediated knockout kit validation

  See Other Versions

CNY 12,260.00


货期*
6周

规格
    • 1 kit

Product images

经常一起买 (3)
pCAS-Scramble, pCas-Guide vector with a scrambled sequence as a negative control (10 µg)
    • 10 ug

CNY 3,710.00


Mouse monoclonal anti-GAPDH antibody, clone OTI2D9 (formerly 2D9), loading control
    • 100 ul

CNY 600.00


GAPDH (untagged)-Human glyceraldehyde-3-phosphate dehydrogenase (GAPDH)
    • 10 ug

CNY 2,950.00

Specifications

Product Data
Format 2 gRNA vectors, 1 mBFP-Neo donor, 1 scramble control
Donor DNA mBFP-Neo
Symbol GAPDH
Locus ID 2597
Kit Components

KN202309G1, GAPDH gRNA vector 1 in pCas-Guide CRISPR vector, Target Sequence: CAAGGCTCGTAGACGCGGTT

KN202309G2, GAPDH gRNA vector 2 in pCas-Guide CRISPR vector, Target Sequence: TCAACGGGTGAGTTCGCGGG

KN202309BN-D, donor DNA containing left and right homologous arms and mBFP-Neo functional cassette.

GE100003, scramble sequence in pCas-Guide vector

Disclaimer These products are manufactured and supplied by OriGene under license from ERS. The kit is designed based on the best knowledge of CRISPR technology. The system has been functionally validated for knocking-in the cassette downstream the native promoter. The efficiency of the knock-out varies due to the nature of the biology and the complexity of the experimental process.
Reference Data
RefSeq NM_001256799, NM_001289745, NM_001289746, NM_002046, NM_001357943, NR_152150
Synonyms G3PD; GAPD; HEL-S-162eP
Summary This gene encodes a member of the glyceraldehyde-3-phosphate dehydrogenase protein family. The encoded protein has been identified as a moonlighting protein based on its ability to perform mechanistically distinct functions. The product of this gene catalyzes an important energy-yielding step in carbohydrate metabolism, the reversible oxidative phosphorylation of glyceraldehyde-3-phosphate in the presence of inorganic phosphate and nicotinamide adenine dinucleotide (NAD). The encoded protein has additionally been identified to have uracil DNA glycosylase activity in the nucleus. Also, this protein contains a peptide that has antimicrobial activity against E. coli, P. aeruginosa, and C. albicans. Studies of a similar protein in mouse have assigned a variety of additional functions including nitrosylation of nuclear proteins, the regulation of mRNA stability, and acting as a transferrin receptor on the cell surface of macrophage. Many pseudogenes similar to this locus are present in the human genome. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2014]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Other Versions

Customer Reviews 
Loading...