CD20 (MS4A1) Human Gene Knockout Kit (CRISPR)

CAT#: KN201242LP

MS4A1 - human gene knockout kit via CRISPR, HDR mediated




 HDR-mediated knockout kit validation

  See Other Versions

CNY 12260.00


货期*
6周

规格
    • 1 kit

Product images

推荐一起购买 (3)
pCAS-Scramble, pCas-Guide vector with a scrambled sequence as a negative control (10 µg)
    • 10 ug

CNY 3710.00


MS4A1 (CD20) mouse monoclonal antibody, clone OTI4B4 (formerly 4B4)
    • 100 ul

CNY 1999.00
CNY 2700.00


MS4A1 (Myc-DDK-tagged)-Human membrane-spanning 4-domains, subfamily A, member 1 (MS4A1), transcript variant 3
    • 10 ug

CNY 2400.00
CNY 4465.00

Specifications

Product Data
Format 2 gRNA vectors, 1 Luciferase-Puro donor, 1 scramble control
Donor DNA Luciferase-Puro
Symbol CD20
Locus ID 931
Kit Components

KN201242G1, CD20 gRNA vector 1 in pCas-Guide CRISPR vector, Target Sequence: GGCCCTATTGCTATGCAATC

KN201242G2, CD20 gRNA vector 2 in pCas-Guide CRISPR vector, Target Sequence: ATCCTCCTGAAGAGTGGTTT

KN201242LP-D, donor DNA containing left and right homologous arms and Luciferase-Puro functional cassette.

GE100003, scramble sequence in pCas-Guide vector

Disclaimer These products are manufactured and supplied by OriGene under license from ERS. The kit is designed based on the best knowledge of CRISPR technology. The system has been functionally validated for knocking-in the cassette downstream the native promoter. The efficiency of the knock-out varies due to the nature of the biology and the complexity of the experimental process.
Reference Data
RefSeq NM_021950, NM_152866, NM_152867
Synonyms B1; Bp35; CD20; CVID5; LEU-16; MS4A2; S7
Summary This gene encodes a member of the membrane-spanning 4A gene family. Members of this nascent protein family are characterized by common structural features and similar intron/exon splice boundaries and display unique expression patterns among hematopoietic cells and nonlymphoid tissues. This gene encodes a B-lymphocyte surface molecule which plays a role in the development and differentiation of B-cells into plasma cells. This family member is localized to 11q12, among a cluster of family members. Alternative splicing of this gene results in two transcript variants which encode the same protein. [provided by RefSeq, Jul 2008]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Other Versions

Customer Reviews 
Loading...