Sodium Potassium ATPase (ATP1A1) Human Gene Knockout Kit (CRISPR)
CAT#: KN201009BN
ATP1A1 - human gene knockout kit via CRISPR, HDR mediated
HDR-mediated knockout kit validation
CNY 12260.00
CNY 3710.00
CNY 5381.00
CNY 7128.00
CNY 7600.00
Specifications
Product Data | |
Format | 2 gRNA vectors, 1 mBFP-Neo donor, 1 scramble control |
Donor DNA | mBFP-Neo |
Symbol | Sodium Potassium ATPase |
UniProt ID | P05023 |
Locus ID | 476 |
Kit Components |
KN201009G1, Sodium Potassium ATPase gRNA vector 1 in pCas-Guide CRISPR vector, Target Sequence: GTGAGTGTCCGGCGCGCCCG KN201009G2, Sodium Potassium ATPase gRNA vector 2 in pCas-Guide CRISPR vector, Target Sequence: GGAAGTCGGGAGGGCGACCG KN201009BN-D, donor DNA containing left and right homologous arms and mBFP-Neo functional cassette. GE100003, scramble sequence in pCas-Guide vector |
Disclaimer | These products are manufactured and supplied by OriGene under license from ERS. The kit is designed based on the best knowledge of CRISPR technology. The system has been functionally validated for knocking-in the cassette downstream the native promoter. The efficiency of the knock-out varies due to the nature of the biology and the complexity of the experimental process. |
Reference Data | |
RefSeq | NM_000701, NM_001001586, NM_001160233, NM_001160234 |
Synonyms | MGC3285; MGC51750 |
Summary | The protein encoded by this gene belongs to the family of P-type cation transport ATPases, and to the subfamily of Na+/K+ -ATPases. Na+/K+ -ATPase is an integral membrane protein responsible for establishing and maintaining the electrochemical gradients of Na and K ions across the plasma membrane. These gradients are essential for osmoregulation, for sodium-coupled transport of a variety of organic and inorganic molecules, and for electrical excitability of nerve and muscle. This enzyme is composed of two subunits, a large catalytic subunit (alpha) and a smaller glycoprotein subunit (beta). The catalytic subunit of Na+/K+ -ATPase is encoded by multiple genes. This gene encodes an alpha 1 subunit. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2009] |
Documents
Product Manuals |
FAQs |
Resources
基因表达相关资源 |
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
KN201009 | ATP1A1 - human gene knockout kit via CRISPR, HDR mediated |
CNY 12260.00 |
|
KN201009LP | ATP1A1 - human gene knockout kit via CRISPR, HDR mediated |
CNY 12260.00 |
|
KN201009RB | ATP1A1 - human gene knockout kit via CRISPR, HDR mediated |
CNY 12260.00 |
|
KN401009 | ATP1A1 - KN2.0, Human gene knockout kit via CRISPR, non-homology mediated. |
CNY 8680.00 |
|
GA100333 | ATP1A1 CRISPRa kit - CRISPR gene activation of human ATPase Na+/K+ transporting subunit alpha 1 |
CNY 12255.00 |
其它Sodium Potassium ATPase产品