Mouse C730036E19Rik activation kit by CRISPRa

CAT#: GA217368

C730036E19Rik CRISPRa kit - CRISPR gene activation of mouse RIKEN cDNA C730036E19 gene



CNY 12255.00


货期*
4周

规格
    • 1 kit

Product images

Specifications

Product Data
Format 3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug)
Symbol C730036E19Rik
Locus ID 402734
Kit Components

GA217368G1, C730036E19Rik gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: GTGATAGCGAGTAGACTCTT

GA217368G2, C730036E19Rik gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: CTTAGTGTCAAGGGCTGAGC

GA217368G3, C730036E19Rik gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: CCTCAAGGAGTAAGAAGCCC

1 CRISPRa-Enhancer vector, SKU GE100056

1 CRISPRa scramble vector, SKU GE100077

Reference Data
RefSeq NR_038011
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...