Mouse Piezo1 activation kit by CRISPRa

CAT#: GA214575

Piezo1 CRISPRa kit - CRISPR gene activation of mouse piezo-type mechanosensitive ion channel component 1



  See Other Versions

CNY 12255.00


货期*
4周

规格
    • 1 kit

Product images

Specifications

Product Data
Format 3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug)
Symbol Piezo1
Locus ID 234839
Kit Components

GA214575G1, Piezo1 gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: CGAAAGTTGCTCCAACCACG

GA214575G2, Piezo1 gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: GTTACTCGCACTGTGCCCGT

GA214575G3, Piezo1 gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: CACAGTGCGAGTAACTGCGC

1 CRISPRa-Enhancer vector, SKU GE100056

1 CRISPRa scramble vector, SKU GE100077

Reference Data
RefSeq NM_001037298, NM_001357349
Synonyms 9630020g22; Fam38a; mKIAA0233
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Other Versions

Customer Reviews 
Loading...