Mouse Ticam2 activation kit by CRISPRa
CAT#: GA213776
Ticam2 CRISPRa kit - CRISPR gene activation of mouse toll-like receptor adaptor molecule 2
CNY 12255.00
Specifications
Product Data | |
Format | 3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug) |
Symbol | Ticam2 |
Locus ID | 225471 |
Kit Components | GA213776G1, Ticam2 gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: TCTCACTACGCCGTTCATAA GA213776G2, Ticam2 gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: TTTTGAGCTATGACTTGCAT GA213776G3, Ticam2 gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: CTATGACTTGCATTGGAGTC 1 CRISPRa-Enhancer vector, SKU GE100056 1 CRISPRa scramble vector, SKU GE100077 |
Reference Data | |
RefSeq | NM_173394 |
Synonyms | B430113A10; TICAM-2; Tirp; TRAM; Trif |
Summary | Functions as sorting adapter in different signaling pathways to facilitate downstream signaling leading to type I interferon induction. In TLR4 signaling, physically bridges TLR4 and TICAM1 and functionally transmits signal to TICAM1 in early endosomes after endocytosis of TLR4. In TLR2 signaling, physically bridges TLR2 and MYD88 and is required for the TLR2-dependent movement of MYD88 to endosomes following ligand engagement. Involved in IL-18 signaling and is proposed to function as a sorting adapter for MYD88 in IL-18 signaling during adaptive immune response. Forms a complex with RAB11FIP2 that is recruited to the phagosomes to promote the activation of the actin-regulatory GTPases RAC1 and CDC42 and subsequent phagocytosis of Gram-negative bacteria.[UniProtKB/Swiss-Prot Function] |
Documents
Resources
基因表达相关资源 |
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
KN517558 | Ticam2 - KN2.0, Mouse gene knockout kit via CRISPR, non-homology mediated. |
CNY 8680.00 |