Mouse Ticam2 activation kit by CRISPRa

CAT#: GA213776

Ticam2 CRISPRa kit - CRISPR gene activation of mouse toll-like receptor adaptor molecule 2



  See Other Versions

CNY 12255.00


货期*
4周

规格
    • 1 kit

Product images

Specifications

Product Data
Format 3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug)
Symbol Ticam2
Locus ID 225471
Kit Components

GA213776G1, Ticam2 gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: TCTCACTACGCCGTTCATAA

GA213776G2, Ticam2 gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: TTTTGAGCTATGACTTGCAT

GA213776G3, Ticam2 gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: CTATGACTTGCATTGGAGTC

1 CRISPRa-Enhancer vector, SKU GE100056

1 CRISPRa scramble vector, SKU GE100077

Reference Data
RefSeq NM_173394
Synonyms B430113A10; TICAM-2; Tirp; TRAM; Trif
Summary Functions as sorting adapter in different signaling pathways to facilitate downstream signaling leading to type I interferon induction. In TLR4 signaling, physically bridges TLR4 and TICAM1 and functionally transmits signal to TICAM1 in early endosomes after endocytosis of TLR4. In TLR2 signaling, physically bridges TLR2 and MYD88 and is required for the TLR2-dependent movement of MYD88 to endosomes following ligand engagement. Involved in IL-18 signaling and is proposed to function as a sorting adapter for MYD88 in IL-18 signaling during adaptive immune response. Forms a complex with RAB11FIP2 that is recruited to the phagosomes to promote the activation of the actin-regulatory GTPases RAC1 and CDC42 and subsequent phagocytosis of Gram-negative bacteria.[UniProtKB/Swiss-Prot Function]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Other Versions

Customer Reviews 
Loading...