Mouse Xist activation kit by CRISPRa

Specifications

Product Data
Format	3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug)
Symbol	Xist
Locus ID	213742
Kit Components	GA213173G1, Xist gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: AACTTCTAGTGTCCAAGACG GA213173G2, Xist gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: TATAATATAGTTAGACCTAA GA213173G3, Xist gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: TTGCAATTCTGACATCTTAT 1 CRISPRa-Enhancer vector, SKU GE100056 1 CRISPRa scramble vector, SKU GE100077
Reference Data
RefSeq	NR_001463, NR_001570
Summary	X inactivation is an early developmental process in mammalian females that transcriptionally silences one of the pair of X chromosomes, thus providing dosage equivalence between males and females. The process is regulated by several factors, including a region of chromosome X called the X inactivation center (XIC). The XIC comprises several non-coding and protein-coding genes, and this gene was the first non-coding gene identified within the XIC. This gene is expressed exclusively from the XIC of the inactive X chromosome. It is essential for the initiation and spread of X-inactivation. It silences hundreds of genes by recruiting and tethering repressive chromatin-modifying complexes to the inactive X chromosome. Alternatively spliced transcript variants have been identified. [provided by RefSeq, Apr 2012]

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.