Mouse Gusb activation kit by CRISPRa

CAT#: GA212271

Gusb CRISPRa kit - CRISPR gene activation of mouse glucuronidase, beta



  See Other Versions

CNY 12255.00


货期*
4周

规格
    • 1 kit

Product images

Specifications

Product Data
Format 3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug)
Symbol Gusb
Locus ID 110006
Kit Components

GA212271G1, Gusb gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: GGGAGTTTGTTATTAAAGCC

GA212271G2, Gusb gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: TCTTAGCCTAGTGGTCCTGA

GA212271G3, Gusb gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: GCTTGCCCCTCAGGACCACT

1 CRISPRa-Enhancer vector, SKU GE100056

1 CRISPRa scramble vector, SKU GE100077

Reference Data
RefSeq NM_010368, NM_001357025, NM_001357026, NM_001357027
Synonyms AI747421; asd; g; Gur; Gus; Gus-r; Gus-s; Gus-t; Gus-u; Gut
Summary Plays an important role in the degradation of dermatan and keratan sulfates.[UniProtKB/Swiss-Prot Function]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Other Versions

Customer Reviews 
Loading...