Mouse Eldr activation kit by CRISPRa

CAT#: GA209328

Eldr CRISPRa kit - CRISPR gene activation of mouse Egfr long non-coding downstream RNA



CNY 12255.00


货期*
4周

规格
    • 1 kit

Product images

Specifications

Product Data
Format 3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug)
Symbol Eldr
Locus ID 72735
Kit Components

GA209328G1, Eldr gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: TCGGGCAAGACTAGTTCTCA

GA209328G2, Eldr gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: CGGAAAAGATTCAAATCCGG

GA209328G3, Eldr gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: GGTAAACTACCAATCCCAGA

1 CRISPRa-Enhancer vector, SKU GE100056

1 CRISPRa scramble vector, SKU GE100077

Reference Data
RefSeq NR_015469, NR_110421, NR_110422, NR_110423, NR_110424, NR_110425
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...