Mouse Malat1 activation kit by CRISPRa

CAT#: GA209185

Malat1 CRISPRa kit - CRISPR gene activation of mouse metastasis associated lung adenocarcinoma transcript 1 (non-coding RNA)



CNY 12255.00


货期*
4周

规格
    • 1 kit

Product images

Specifications

Product Data
Format 3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug)
Symbol Malat1
Locus ID 72289
Kit Components

GA209185G1, Malat1 gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: AGATTTTTCTTGACGTCGTG

GA209185G2, Malat1 gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: TTCTTCCTTCACCAAGGTGG

GA209185G3, Malat1 gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: AAAGGGACACGTCACTCCAC

1 CRISPRa-Enhancer vector, SKU GE100056

1 CRISPRa scramble vector, SKU GE100077

Reference Data
RefSeq NR_002847
Summary This gene produces a long non-coding RNA that is cleaved into a mature, functional transcript as well as a small cytoplasmic RNA (mascRNA). The mature transcript is stabilized by a 3' triple helical structure and is retained in the nucleus. This transcript functions in the regulation of gene expression and proliferation and may be upregulated in tumors. [provided by RefSeq, Nov 2016]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...