Mouse Dnmt3l activation kit by CRISPRa

Specifications

Product Data
Format	3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug)
Symbol	Dnmt3l
Locus ID	54427
Kit Components	GA205712G1, Dnmt3l gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: CGACGGTTCTTAAGCTGTGA GA205712G2, Dnmt3l gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: GGGTCATGTTGACGGATCCA GA205712G3, Dnmt3l gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: TGTGACTCCAAGTTGCCATC 1 CRISPRa-Enhancer vector, SKU GE100056 1 CRISPRa scramble vector, SKU GE100077
Reference Data
RefSeq	NM_001081695, NM_001284197, NM_001284198, NM_001284199, NM_001284200, NM_019448
Synonyms	D6Ertd14e; ecat7
Summary	CpG methylation is an epigenetic modification that is important for embryonic development, imprinting, and X-chromosome inactivation. Studies in mice have demonstrated that DNA methylation is required for mammalian development. This gene encodes a nuclear protein that is a catalytically inactive regulatory factor of DNA methyltransferases. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2015]

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.