Mouse St8sia4 activation kit by CRISPRa

Specifications

Product Data
Format	3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug)
Symbol	St8sia4
Locus ID	20452
Kit Components	GA203901G1, St8sia4 gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: GGATTTCACTGTGCTTCGGT GA203901G2, St8sia4 gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: ATCCCACCAGAGGAACGCAA GA203901G3, St8sia4 gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: CCTAGGACGCCCAAACGTCA 1 CRISPRa-Enhancer vector, SKU GE100056 1 CRISPRa scramble vector, SKU GE100077
Reference Data
RefSeq	NM_001159745, NM_009183
Synonyms	PST; PST-1; SIAT8-D; Siat8d; ST8SiaIV
Summary	Catalyzes the polycondensation of alpha-2,8-linked sialic acid required for the synthesis of polysialic acid (PSA), which is present on the embryonic neural cell adhesion molecule (N-CAM), necessary for plasticity of neural cells.[UniProtKB/Swiss-Prot Function]

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.