Mouse Sirpa activation kit by CRISPRa

CAT#: GA203483

Sirpa CRISPRa kit - CRISPR gene activation of mouse signal-regulatory protein alpha



  See Other Versions

CNY 12255.00


货期*
4周

规格
    • 1 kit

Product images

Specifications

Product Data
Format 3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug)
Symbol Sirpa
Locus ID 19261
Kit Components

GA203483G1, Sirpa gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: GGGGACTCACAGCAACGGAT

GA203483G2, Sirpa gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: ACACCGACCTGCCTGGGATT

GA203483G3, Sirpa gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: CCTATGCTGCTCATCTGTTC

1 CRISPRa-Enhancer vector, SKU GE100056

1 CRISPRa scramble vector, SKU GE100077

Reference Data
RefSeq NM_001177646, NM_001177647, NM_001291019, NM_001291020, NM_001291021, NM_001291022, NM_007547, NM_001355158, NM_001355160
Synonyms AI835480; Bit; CD172a; P84; Ptpns1; SHP-1; SHPS-1; SIRP
Summary Immunoglobulin-like cell surface receptor for CD47. Acts as docking protein and induces translocation of PTPN6, PTPN11 and other binding partners from the cytosol to the plasma membrane. Supports adhesion of cerebellar neurons, neurite outgrowth and glial cell attachment. May play a key role in intracellular signaling during synaptogenesis and in synaptic function. Involved in the negative regulation of receptor tyrosine kinase-coupled cellular responses induced by cell adhesion, growth factors or insulin. Mediates negative regulation of phagocytosis, mast cell activation and dendritic cell activation. CD47 binding prevents maturation of immature dendritic cells and inhibits cytokine production by mature dendritic cells (By similarity).[UniProtKB/Swiss-Prot Function]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Other Versions

Customer Reviews 
Loading...