Mouse Ascl1 activation kit by CRISPRa

Specifications

Product Data
Format	3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug)
Symbol	Ascl1
Locus ID	17172
Kit Components	GA202576G1, Ascl1 gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: AGGGAGGGAGCTGAGGAGGT GA202576G2, Ascl1 gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: GGGAAGAGGAGGGGTAGTGG GA202576G3, Ascl1 gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: CGGTGCGGCCGCCTTTTCAA 1 CRISPRa-Enhancer vector, SKU GE100056 1 CRISPRa scramble vector, SKU GE100077
Reference Data
RefSeq	NM_008553
Synonyms	AI225900; ASH1; bHLHa46; Mash1
Summary	Transcription factor that plays a key role in neuronal differentiation: acts as a pioneer transcription factor, accessing closed chromatin to allow other factors to bind and activate neural pathways (PubMed:24243019). Directly binds the E box motif (5'-CANNTG-3') on promoters and promotes transcription of neuronal genes (PubMed:20107439, PubMed:24243019, PubMed:27281220). The combination of three transcription factors, ASCL1, POU3F2/BRN2 and MYT1L, is sufficient to reprogram fibroblasts and other somatic cells into induced neuronal (iN) cells in vitro (PubMed:20107439, PubMed:24243019, PubMed:27281220). Plays a role at early stages of development of specific neural lineages in most regions of the CNS, and of several lineages in the PNS (PubMed:8217843). Essential for the generation of olfactory and autonomic neurons (PubMed:8221886). Acts synergistically with FOXN4 to specify the identity of V2b neurons rather than V2a from bipotential p2 progenitors during spinal cord neurogenesis, probably through DLL4-NOTCH signaling activation (PubMed:16020526, PubMed:17728344).[UniProtKB/Swiss-Prot Function]

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.