Mouse Gata3 activation kit by CRISPRa

CAT#: GA201553

Gata3 CRISPRa kit - CRISPR gene activation of mouse GATA binding protein 3



  See Other Versions

CNY 12255.00


货期*
4周

规格
    • 1 kit

Product images

Specifications

Product Data
Format 3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug)
Symbol Gata3
Locus ID 14462
Kit Components

GA201553G1, Gata3 gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: TTAAAGGGGTGCTACTGCGC

GA201553G2, Gata3 gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: AAGTCTTAACTGGAGGAAGT

GA201553G3, Gata3 gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: GACTTTTGGGAGCAATGACG

1 CRISPRa-Enhancer vector, SKU GE100056

1 CRISPRa scramble vector, SKU GE100077

Reference Data
RefSeq NM_008091, NM_001355110, NM_001355111, NM_001355112
Synonyms Gata-3; jal
Summary Transcriptional activator which binds to the enhancer of the T-cell receptor alpha and delta genes. Binds to the consensus sequence 5'-AGATAG-3'. Required for the T-helper 2 (Th2) differentiation process following immune and inflammatory responses.[UniProtKB/Swiss-Prot Function]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Other Versions

Customer Reviews 
Loading...