Mouse Fut1 activation kit by CRISPRa
CAT#: GA201485
Fut1 CRISPRa kit - CRISPR gene activation of mouse fucosyltransferase 1
CNY 12255.00
Specifications
| Product Data | |
| Format | 3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug) |
| Symbol | Fut1 |
| Locus ID | 14343 |
| Kit Components | GA201485G1, Fut1 gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: ACTCCCAGAGCATCTAGCTA GA201485G2, Fut1 gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: CGTATCCTCTGTATGGACCC GA201485G3, Fut1 gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: GGGTTCTCTGACTTGCACGA 1 CRISPRa-Enhancer vector, SKU GE100056 1 CRISPRa scramble vector, SKU GE100077 |
| Reference Data | |
| RefSeq | NM_001271981, NM_008051 |
| Summary | This gene is one of three genes in mouse which encode a galactoside 2-L-fucosyltransferase. These genes differ in their developmental- and tissue-specific expression. The encoded type II membrane protein is anchored in the Golgi apparatus and controls the final step in the creation of alpha (1,2) fucosylated carbhohydrates by the addition of a terminal fucose in an alpha (1,2) linkage. This enzyme is required for the synthesis of the Lewis antigen as well as the H-antigen, a precursor of the A and B antigens of the ABH histo-blood group. The biological function of the fucosylated carbhohydrate products is thought to involve cell-adhesion and interactions with microorganisms. Disruption of this gene impairs development of the olfactory nerve and maturation of the glomerular layer of the main olfactory bulb. Alternative splicing results in multiple transcript variants which encode distinct isoforms. [provided by RefSeq, Dec 2012] |
Documents
Resources
| 基因表达相关资源 |
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| KN506178 | Fut1 - KN2.0, Mouse gene knockout kit via CRISPR, non-homology mediated. |
CNY 8680.00 |
