Mouse Fgf18 activation kit by CRISPRa

CAT#: GA201399

Fgf18 CRISPRa kit - CRISPR gene activation of mouse fibroblast growth factor 18



  See Other Versions

CNY 12255.00


货期*
4周

规格
    • 1 kit

Product images

Specifications

Product Data
Format 3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug)
Symbol Fgf18
Locus ID 14172
Kit Components

GA201399G1, Fgf18 gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: GGAAGCTGGACTGAAGCGGG

GA201399G2, Fgf18 gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: TCAGTCCAGCTTCCCCGCAC

GA201399G3, Fgf18 gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: TTCTGCAGACTCTGCTGCTC

1 CRISPRa-Enhancer vector, SKU GE100056

1 CRISPRa scramble vector, SKU GE100077

Reference Data
RefSeq NM_008005, NR_102395
Synonyms D130055P09Rik; FGF-18
Summary Plays an important role in the regulation of cell proliferation, cell differentiation and cell migration. Required for normal ossification and bone development. Stimulates hepatic and intestinal proliferation (By similarity).[UniProtKB/Swiss-Prot Function]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Other Versions

Customer Reviews 
Loading...