Mouse Col6a3 activation kit by CRISPRa

CAT#: GA200823

Col6a3 CRISPRa kit - CRISPR gene activation of mouse collagen, type VI, alpha 3



CNY 12255.00


货期*
4周

规格
    • 1 kit

Product images

Specifications

Product Data
Format 3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug)
Symbol Col6a3
Locus ID 12835
Kit Components

GA200823G1, Col6a3 gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: TTGCCTTACAAGCATTTAGC

GA200823G2, Col6a3 gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: CAAGCTGATGTCACCTATGA

GA200823G3, Col6a3 gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: TACAGTTTGGGTCTGTCCTA

1 CRISPRa-Enhancer vector, SKU GE100056

1 CRISPRa scramble vector, SKU GE100077

Reference Data
RefSeq NM_001243008, NM_001243009, NM_009935
Synonyms AI507288; Col6a-3
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...