Mouse Calb2 activation kit by CRISPRa

Specifications

Product Data
Format	3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug)
Symbol	Calb2
Locus ID	12308
Kit Components	GA200493G1, Calb2 gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: CCTGTCCTGTGACTCCCTCG GA200493G2, Calb2 gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: CATTTCCAGCTAAATACCTG GA200493G3, Calb2 gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: AGACTTCTGGGTGCCCTCCG 1 CRISPRa-Enhancer vector, SKU GE100056 1 CRISPRa scramble vector, SKU GE100077
Reference Data
RefSeq	NM_007586, NM_001368293, NM_001368294
Synonyms	CR
Summary	Calretinin is a calcium-binding protein which is abundant in auditory neurons.[UniProtKB/Swiss-Prot Function]

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.