Mouse Cacng1 activation kit by CRISPRa

Specifications

Product Data
Format	3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug)
Symbol	Cacng1
Locus ID	12299
Kit Components	GA200487G1, Cacng1 gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: AGAGTGGATACGGATAGTGG GA200487G2, Cacng1 gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: CGTGGCACTGAGGATTCCTT GA200487G3, Cacng1 gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: CATTAATAGAAGTCTTCCTC 1 CRISPRa-Enhancer vector, SKU GE100056 1 CRISPRa scramble vector, SKU GE100077
Reference Data
RefSeq	NM_007582
Synonyms	MGC117703
Summary	Regulatory subunit of the voltage-gated calcium channel that gives rise to L-type calcium currents in skeletal muscle. Regulates channel inactivation kinetics.[UniProtKB/Swiss-Prot Function]

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.