Human PIGBOS1 activation kit by CRISPRa

CAT#: GA119487

PIGBOS1 CRISPRa kit - CRISPR gene activation of human PIGB opposite strand 1



CNY 12255.00


货期*
4周

规格
    • 1 kit

Product images

Specifications

Product Data
Format 3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug)
Symbol PIGBOS1
Locus ID 101928527
Kit Components

GA119487G1, PIGBOS1 gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: CTCCTGGGTGTTGAAGTACA

GA119487G2, PIGBOS1 gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: TACCTTGTACTTCAACACCC

GA119487G3, PIGBOS1 gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: GCTCGTCCATCCATTAAGTT

1 CRISPRa-Enhancer vector, SKU GE100056

1 CRISPRa scramble vector, SKU GE100077

Reference Data
RefSeq NM_001308421, NM_001308422, NM_001308423
Summary Plays a role in regulation of the unfolded protein response triggered by endoplasmic reticulum (ER) stress resulting from the presence of unfolded proteins in the ER lumen.[UniProtKB/Swiss-Prot Function]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...