Human PGP activation kit by CRISPRa

Specifications

Product Data
Format	3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug)
Symbol	PGP
Locus ID	283871
Kit Components	GA117067G1, PGP gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: GAGCGCTTCACTCCGAATGC GA117067G2, PGP gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: TGGCGAAGGTGCAGGCCAAT GA117067G3, PGP gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: TTGGCTGGCAGGGCTCCAAC 1 CRISPRa-Enhancer vector, SKU GE100056 1 CRISPRa scramble vector, SKU GE100077
Disclaimer	These products are manufactured and supplied by OriGene under license from ERS. The kit is designed based on the best knowledge of CRISPRa SAM technology. The efficiency of the activation can be affected by many factors, including nucleosome occupancy status, chromatin structure and the gene expression level of the target, etc.
Reference Data
RefSeq	NM_001042371
Synonyms	AUM; G3PP; PGPase
Summary	Glycerol-3-phosphate phosphatase hydrolyzing glycerol-3-phosphate into glycerol. Thereby, regulates the cellular levels of glycerol-3-phosphate a metabolic intermediate of glucose, lipid and energy metabolism. Was also shown to have a 2-phosphoglycolate phosphatase activity and a tyrosine-protein phosphatase activity. However, their physiological relevance is unclear (PubMed:26755581). In vitro, has also a phosphatase activity toward ADP, ATP, GDP and GTP (By similarity).[UniProtKB/Swiss-Prot Function]

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.