Human APOBEC3A activation kit by CRISPRa

Specifications

Product Data
Format	3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug)
Symbol	APOBEC3A
Locus ID	200315
Kit Components	GA116344G1, APOBEC3A gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: CCATGCCTCTGGGCAAGCTT GA116344G2, APOBEC3A gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: CTTTGCTCCCTGTGGGCCAC GA116344G3, APOBEC3A gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: CCTGAGCTGGAGAAGGGGTG 1 CRISPRa-Enhancer vector, SKU GE100056 1 CRISPRa scramble vector, SKU GE100077
Reference Data
RefSeq	NM_001270406, NM_145699
Synonyms	A3A; ARP3; bK150C2.1; PHRBN
Summary	This gene is a member of the cytidine deaminase gene family. It is one of seven related genes or pseudogenes found in a cluster, thought to result from gene duplication, on chromosome 22. Members of the cluster encode proteins that are structurally and functionally related to the C to U RNA-editing cytidine deaminase APOBEC1. The protein encoded by this gene lacks the zinc binding activity of other family members. The protein plays a role in immunity, by restricting transmission of foreign DNA such as viruses. One mechanism of foreign DNA restriction is deamination of foreign double-stranded DNA cytidines to uridines, which leads to DNA degradation. However, other mechanisms are also thought to be involved, as anti-viral effect is not dependent on deaminase activity. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2012]

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.