Human USP32 activation kit by CRISPRa

Specifications

Product Data
Format	3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug)
Symbol	USP32
Locus ID	84669
Kit Components	GA113643G1, USP32 gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: TTCACCCCCTTGCCCATCTG GA113643G2, USP32 gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: ATCTCAGCAGGTGTGCCGGT GA113643G3, USP32 gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: GGCGGTTTGGCTCCAGAACT 1 CRISPRa-Enhancer vector, SKU GE100056 1 CRISPRa scramble vector, SKU GE100077
Reference Data
RefSeq	NM_032582
Synonyms	NY-REN-60; USP10

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.