Human NLRC5 activation kit by CRISPRa

Specifications

Product Data
Format	3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug)
Symbol	NLRC5
Locus ID	84166
Kit Components	GA113402G1, NLRC5 gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: GCTCCGCCAGTGCATGGAAC GA113402G2, NLRC5 gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: TCGGACCCAAGGACAGTCCC GA113402G3, NLRC5 gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: CAGCAGGGAGCGGGTGTGTT 1 CRISPRa-Enhancer vector, SKU GE100056 1 CRISPRa scramble vector, SKU GE100077
Reference Data
RefSeq	NM_001330552, NM_032206
Synonyms	CLR16.1; NOD4; NOD27
Summary	This gene encodes a member of the caspase recruitment domain-containing NLR family. This gene plays a role in cytokine response and antiviral immunity through its inhibition of NF-kappa-B activation and negative regulation of type I interferon signaling pathways. [provided by RefSeq, Oct 2011]

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.