Human FTO activation kit by CRISPRa

Specifications

Product Data
Format	3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug)
Symbol	FTO
Locus ID	79068
Kit Components	GA112344G1, FTO gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: AAAGTGAGCCCGACTTTCCA GA112344G2, FTO gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: GCTCACGGTGCACTCTAGGA GA112344G3, FTO gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: CTCAGGGCGACGGCACACCC 1 CRISPRa-Enhancer vector, SKU GE100056 1 CRISPRa scramble vector, SKU GE100077
Reference Data
RefSeq	NM_001080432, NM_001363905, NM_001363988, NM_001363891, NM_001363894, NM_001363896, NM_001363897, NM_001363898, NM_001363899, NM_001363900, NM_001363901, NM_001363903, NR_156761
Synonyms	ALKBH9; BMIQ14; GDFD
Summary	This gene is a nuclear protein of the AlkB related non-haem iron and 2-oxoglutarate-dependent oxygenase superfamily but the exact physiological function of this gene is not known. Other non-heme iron enzymes function to reverse alkylated DNA and RNA damage by oxidative demethylation. Studies in mice and humans indicate a role in nervous and cardiovascular systems and a strong association with body mass index, obesity risk, and type 2 diabetes. [provided by RefSeq, Jul 2011]

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.